Y-SNP Data Record for M269
Name | M269 |
Synonym | None |
NCBI RefSNPID | rs9786153 |
Location: band | q11.222 |
Location: gene | EIF1AY |
Ref Sequence base | 21077492 |
Mutation | C->T |
Primers: fwd | ctaaagatcagagtatctccctttg |
Primers: rev | aaattgttttcaatttaccag |
Length | 379 |
Position | 358 |
Haplogroup | R1b1c |
Equivalent SNPs | none |
About this SNP:
M269 marks the most common haplogroup found in Europe. Its frequency exceeds 80% in parts of
western Europe and it occurs at lower frequencies in central and eastern Europe. It
marks an ancient migration into Europe prior to the LGM and is believed to have survived in
refugia in Iberia, the Balkans and possibly elsewhere before expanding northwards again. It
apparently comprises two major branches defined by DYS1/p49a,f haplotypes 15 and 35
but this branching cannot yet be included in the tree because the underlying mutation
is not verified as a unique event polymorphism.
Relevant Papers
Cruciani et al. 2002
http://www.journals.uchicago.edu/AJHG/journal/issues/v70n5/013596/013596.html
Cinnioglu et al 2004
http://hpgl.stanford.edu/publications/HG_2004_v114_p127-148.pdf
Links
(Most useful links to be agreed by the group)