Page Actions

FTB SNPs 0K

From ISOGG Wiki

The FT SNP index lists Big Y-700 SNPs that have been named by Family Tree DNA as they have been considered for inclusion to the Y chromosome haplotree.

Previous List (FTB10000-FTB19999)


SNP Position (hg38) Mutation
FTB20000 5132730 G to C
FTB20001 5134020 T to C
FTB20002 5135238 G to A
FTB20003 5150216 G to A
FTB20004 5150830 G to A
FTB20005 5155413 C to T
FTB20006 5157117 A to G
FTB20007 5161203 C to T
FTB20008 5170845 T to A
FTB20009 5173116 C to T
FTB20010 5173122 C to A
FTB20011 5173124 A to G
FTB20012 5181770 A to C
FTB20013 5182572 G to C
FTB20014 5189778 C to T
FTB20015 5189834 T to C
FTB20016 5190266 C to G
FTB20017 5193104 C to T
FTB20018 5206099 A to G
FTB20019 5210722 A to T
FTB20020 5211353 G to C
FTB20021 5214263 C to T
FTB20022 5219077 T to G
FTB20023 5244331 G to C
FTB20024 5244620 C to G
FTB20025 5264236 A to G
FTB20026 5265520 A to G
FTB20027 5268975 G to A
FTB20028 5274781 G to A
FTB20029 5286653 A to G
FTB20030 5293358 G to T
FTB20031 5308216 C to G
FTB20032 5308895 A to G
FTB20033 5309931 T to C
FTB20034 5313381 G to T
FTB20035 5321964 A to G
FTB20036 5339296 A to G
FTB20037 5348690 C to G
FTB20038 5349227 G to A
FTB20039 5353129 A to G
FTB20040 5362001 C to A
FTB20041 5366310 A to T
FTB20042 5371723 C to T
FTB20043 5375093 G to A
FTB20044 5383916 C to G
FTB20045 5387690 G to C
FTB20046 5390981 C to T
FTB20047 5391337 C to G
FTB20048 5392116 A to T
FTB20049 5404708 A to G
FTB20050 5408295 A to G
FTB20051 5413099 A to T
FTB20052 5416469 G to A
FTB20053 5416470 G to A
FTB20054 5421625 C to T
FTB20055 5424079 C to T
FTB20056 5433873 A to G
FTB20057 5434137 G to A
FTB20058 5434166 C to A
FTB20059 5435509 G to A
FTB20060 5437030 T to C
FTB20061 5448095 A to G
FTB20062 5476140 G to C
FTB20063 5504342 A to G
FTB20064 5505554 A to G
FTB20065 5507110 A to T
FTB20066 5511860 C to G
FTB20067 5515188 A to C
FTB20068 5517982 T to C
FTB20069 5529213 T to G
FTB20070 5551056 A to G
FTB20071 5554381 T to C
FTB20072 5561800 C to A
FTB20073 5572400 G to A
FTB20074 5576451 T to C
FTB20075 5578071 C to T
FTB20076 5578877 C to T
FTB20077 5584340 G to C
FTB20078 5586373 G to C
FTB20079 5586380 T to C
FTB20080 5603266 C to T
FTB20081 5620550 C to T
FTB20082 5623442 T to C
FTB20083 5624251 G to A
FTB20084 5625591 A to G
FTB20085 5627158 A to C
FTB20086 5629201 G to C
FTB20087 5634399 T to C
FTB20088 5636655 T to A
FTB20089 5639074 A to C
FTB20090 5640159 T to G
FTB20091 5644117 A to G
FTB20092 5644711 G to A
FTB20093 5648444 T to C
FTB20094 5650548 G to C
FTB20095 5657550 A to G
FTB20096 5663405 C to G
FTB20097 5673884 G to C
FTB20098 5674385 A to C
FTB20099 5677097 G to A
FTB20100 5681608 G to A
FTB20101 5684060 C to T
FTB20102 5699206 G to T
FTB20103 5716062 C to A
FTB20104 5716392 G to A
FTB20105 5724157 T to C
FTB20106 5724442 C to G
FTB20107 5732442 A to T
FTB20108 5737977 T to C
FTB20109 5741677 T to C
FTB20110 5747801 C to T
FTB20111 5757334 G to A
FTB20112 5761342 T to C
FTB20113 5766544 C to G
FTB20114 5768239 C to T
FTB20115 5775494 G to T
FTB20116 5777063 C to T
FTB20117 5778052 G to A
FTB20118 5778983 A to G
FTB20119 5785795 G to A
FTB20120 5794865 C to A
FTB20121 5795541 G to A
FTB20122 5796308 G to A
FTB20123 5814029 C to T
FTB20124 5816831 T to G
FTB20125 5821359 T to G
FTB20126 5828831 C to G
FTB20127 5841800 A to G
FTB20128 5844112 G to A
FTB20129 5848392 G to A
FTB20130 5848828 C to T
FTB20131 5856209 G to T
FTB20132 5857750 T to C
FTB20133 5875427 T to C
FTB20134 5885254 T to C
FTB20135 5889249 G to A
FTB20136 5892228 C to T
FTB20137 5901242 T to A
FTB20138 5901483 G to A
FTB20139 5902230 C to T
FTB20140 5904647 G to C
FTB20141 5905128 G to C
FTB20142 5914872 C to T
FTB20143 5920129 T to A
FTB20144 5932411 C to A
FTB20145 5932702 C to T
FTB20146 5933867 T to C
FTB20147 5938156 C to T
FTB20148 5949449 T to G
FTB20149 5958734 A to G
FTB20150 5960028 G to T
FTB20151 5961318 A to C
FTB20152 5967865 A to G
FTB20153 5968315 T to C
FTB20154 5977279 G to A
FTB20155 5986708 C to T
FTB20156 5987770 A to G
FTB20157 5989968 A to G
FTB20158 5994900 T to C
FTB20159 5997557 T to G
FTB20160 5998752 C to T
FTB20161 6004662 A to C
FTB20162 6005300 A to G
FTB20163 6011155 T to C
FTB20164 6013807 G to A
FTB20165 6023173 G to A
FTB20166 6024653 C to T
FTB20167 6025229 T to C
FTB20168 6027258 A to T
FTB20169 6028251 A to G
FTB20170 6038995 T to G
FTB20171 6040081 T to C
FTB20172 6045541 G to A
FTB20173 6046089 T to G
FTB20174 6047823 A to C
FTB20175 6066155 C to T
FTB20176 6066218 G to A
FTB20177 6068106 G to T
FTB20178 6073354 C to T
FTB20179 6076193 G to A
FTB20180 6077724 C to T
FTB20181 6080431 G to C
FTB20182 6083850 T to G
FTB20183 6087380 G to A
FTB20184 6099655 G to T
FTB20185 6105547 A to C
FTB20186 6116035 A to T
FTB20187 6117050 T to G
FTB20188 6117051 G to C
FTB20189 6117052 T to C
FTB20190 6123240 C to T
FTB20191 6124550 T to C
FTB20192 6129239 C to T
FTB20193 6130191 G to A
FTB20194 6132637 C to T
FTB20195 6134459 A to C
FTB20196 6134695 G to A
FTB20197 6145248 C to T
FTB20198 6153861 C to T
FTB20199 6153935 T to G
FTB20200 6155832 C to G
FTB20201 6157492 T to C
FTB20202 6162077 T to C
FTB20203 6163044 G to T
FTB20204 6163062 T to C
FTB20205 6167019 G to C
FTB20206 6180545 G to T
FTB20207 6181117 C to T
FTB20208 6182544 C to T
FTB20209 6183191 G to C
FTB20210 6185377 C to T
FTB20211 6187414 A to T
FTB20212 6191360 T to C
FTB20213 6199262 T to C
FTB20214 6199764 A to G
FTB20215 6200130 T to C
FTB20216 6200670 G to A
FTB20217 6207036 T to C
FTB20218 6209266 C to T
FTB20219 6210225 G to T
FTB20220 6214193 A to C
FTB20221 6223815 C to T
FTB20222 6268237 G to A
FTB20223 6268764 C to A
FTB20224 6397398 A to C
FTB20225 6425743 C to T
FTB20226 6455857 C to T
FTB20227 6462929 C to T
FTB20228 6464969 A to C
FTB20229 6467160 A to G
FTB20230 6489328 T to C
FTB20231 6504192 G to A
FTB20232 6520277 T to C
FTB20233 6522445 A to G
FTB20234 6533725 G to A
FTB20235 6534179 G to A
FTB20236 6535582 G to A
FTB20237 6541641 C to A
FTB20238 6546291 A to C
FTB20239 6548412 T to A
FTB20240 6551203 C to T
FTB20241 6551899 C to T
FTB20242 6555547 C to G
FTB20243 6557202 G to A
FTB20244 6557728 A to G
FTB20245 6563967 G to A
FTB20246 6564226 T to G
FTB20247 6572858 T to C
FTB20248 6579205 A to C
FTB20249 6591652 C to T
FTB20250 6594117 A to G
FTB20251 6594233 G to C
FTB20252 6604416 A to G
FTB20253 6604563 T to A
FTB20254 6605109 C to T
FTB20255 6614249 A to C
FTB20256 6618789 T to C
FTB20257 6621509 T to C
FTB20258 6626500 G to A
FTB20259 6633209 T to C
FTB20260 6652760 C to A
FTB20261 6652844 G to A
FTB20262 6654002 T to C
FTB20263 6663478 C to A
FTB20264 6663588 G to A
FTB20265 6666810 G to T
FTB20266 6668444 C to G
FTB20267 6712611 C to T
FTB20268 6722063 T to G
FTB20269 6728351 G to A
FTB20270 6740339 C to T
FTB20271 6742466 A to T
FTB20272 6746543 T to C
FTB20273 7228731 T to C
FTB20274 7228997 C to G
FTB20275 7304374 G to A
FTB20276 9538703 C to A
FTB20277 9546561 C to G
FTB20278 9547869 C to A
FTB20279 9552191 T to A
FTB20280 9553596 C to T
FTB20281 9623950 A to G
FTB20282 9626432 G to A
FTB20283 9629552 G to C
FTB20284 9633893 T to C
FTB20285 9657789 A to G
FTB20286 9660793 T to G
FTB20287 9666901 T to C
FTB20288 9673226 C to T
FTB20289 9678535 G to C
FTB20290 9678836 T to C
FTB20291 9700397 G to A
FTB20292 9804587 C to T
FTB20293 9807585 G to A
FTB20294 9807853 C to T
FTB20295 9809875 G to C
FTB20296 9811527 G to T
FTB20297 9815937 A to G
FTB20298 9818067 T to A
FTB20299 9848376 A to G
FTB20300 9907287 T to C
FTB20301 9921180 G to T
FTB20302 9927154 T to C
FTB20303 9957454 G to A
FTB20304 10066971 A to C
FTB20305 10071243 G to A
FTB20306 11690697 G to C
FTB20307 11690981 G to A
FTB20308 11693336 A to G
FTB20309 11693339 T to C
FTB20310 11693341 T to G
FTB20311 11693353 A to G
FTB20312 11694012 A to T
FTB20313 11694309 G to A
FTB20314 11694310 A to T
FTB20315 11697840 G to T
FTB20316 11702283 A to C
FTB20317 11704222 G to A
FTB20318 11704458 A to C
FTB20319 11709053 T to C
FTB20320 11709858 G to T
FTB20321 11714499 G to T
FTB20322 11716731 T to C
FTB20323 11720090 A to G
FTB20324 11724572 T to C
FTB20325 11726063 C to A
FTB20326 11728200 T to A
FTB20327 11729543 A to T
FTB20328 11738708 G to A
FTB20329 11745776 C to A
FTB20330 11745812 T to G
FTB20331 11749034 G to A
FTB20332 15876778 T to C
FTB20333 20351586 C to A
FTB20334 20352319 C to A
FTB20335 21488676 A to G
FTB20336 21493490 G to A
FTB20337 21570633 A to C
FTB20338 21572561 C to G
FTB20339 21582734 A to C
FTB20340 21751203 C to T
FTB20341 21807933 G to C
FTB20342 21810168 C to A
FTB20343 22212071 T to C
FTB20344 22217515 G to A
FTB20345 22334942 T to G
FTB20346 22354626 G to A
FTB20347 22354880 T to C
FTB20348 22363236 C to T
FTB20349 22377567 G to C
FTB20350 11453066 C to T
FTB20351 19314169 A to G
FTB20352 10083362 C to G
FTB20353 10771963 C to T
FTB20354 10783117 G to A
FTB20355 10817860 C to T
FTB20356 10846437 A to G
FTB20357 10934040 C to T
FTB20358 10994023 A to G
FTB20359 11025223 A to C
FTB20360 11051391 T to A
FTB20361 11101513 G to C
FTB20362 10191599 G to C
FTB20363 11127157 G to C
FTB20364 11154284 C to G
FTB20365 11372928 G to A
FTB20366 11390784 G to A
FTB20367 11396482 T to A
FTB20368 10181548 C to A
FTB20369 11125286 G to T
FTB20370 20101388 A to T
FTB20371 10750464 A to G
FTB20372 12511877 T to C
FTB20373 11082551 C to G
FTB20374 11469198 T to A
FTB20375 11490492 G to A
FTB20376 11044808 G to A
FTB20377 11389782 C to A
FTB20378 11952607 T to A
FTB20379 12929643 G to C
FTB20380 16847152 C to A
FTB20381 19250344 T to G
FTB20382 16683546 C to G
FTB20383 4082829 C to G
FTB20384 11663434 A to G
FTB20385 21277915 C to G
FTB20386 15753572 T to C
FTB20387 19910981 TA to T
FTB20388 14305574 A to T
FTB20389 7195207 C to A
FTB20390 7260142 G to A
FTB20391 11282528 C to G
FTB20392 11345207 T to C
FTB20393 11170565 T to A
FTB20394 11561130 T to A
FTB20395 11129664 G to A
FTB20396 11104022 G to C
FTB20397 11370022 C to T
FTB20398 11480092 C to A
FTB20399 11119469 G to T
FTB20400 11340419 A to C
FTB20401 10228725 C to T
FTB20402 11327992 C to A
FTB20403 11051467 C to A
FTB20404 20297287 C to T
FTB20405 22339515 T to A
FTB20406 10622836 C to T
FTB20407 8511009 C to A
FTB20408 10824293 A to G
FTB20409 10204725 T to A
FTB20410 10862232 T to G
FTB20411 10956462 G to A
FTB20412 11088355 C to T
FTB20413 11395776 C to T
FTB20414 7345119 A to G
FTB20415 10993382 C to T
FTB20416 10800268 T to C
FTB20417 14133686 G to A
FTB20418 11465929 G to A
FTB20419 10844255 C to T
FTB20420 11171996 C to A
FTB20421 10942031 C to T
FTB20422 11209304 G to T
FTB20423 14677745 T to A
FTB20424 15188709 G to A
FTB20425 7536362 ACAGA to A
FTB20426 19647017 T to A
FTB20427 10762735 C to A
FTB20428 10762745 C to G
FTB20429 10764462 C to G
FTB20430 10744557 A to G
FTB20431 10929511 C to T
FTB20432 11290434 C to T
FTB20433 11439578 G to A
FTB20434 11456663 G to C
FTB20435 10846187 A to T
FTB20436 10973103 C to T
FTB20437 10678751 T to C
FTB20438 10184974 G to T
FTB20439 10773694 C to T
FTB20440 10775258 C to G
FTB20441 10989421 C to A
FTB20442 11022240 C to G
FTB20443 4848473 C to CC
FTB20444 6627039 G to A
FTB20445 10664000 C to T
FTB20446 20283673 G to A
FTB20447 11375010 T to A
FTB20448 10246075 T to C
FTB20449 11668147 T to A
FTB20450 17034792 G to A
FTB20451 7276198 G to GG
FTB20452 10230667 C to T
FTB20453 8598295 G to C
FTB20454 10843105 C to T
FTB20455 11535496 C to T
FTB20456 10746637 C to T
FTB20457 11356941 G to T
FTB20458 13312350 G to A
FTB20459 12058874 G to A
FTB20460 16736141 C to T
FTB20461 20358987 T to C
FTB20462 17430318 G to C
FTB20463 14359596 T to G
FTB20464 11938192 G to A
FTB20465 12855365 C to A
FTB20466 17221485 T to C
FTB20467 11173138 G to C
FTB20468 10765211 T to C
FTB20469 20002376 A to G
FTB20470 20002383 C to A
FTB20471 10165900 G to A
FTB20472 20305805 A to T
FTB20473 12899355 A to G
FTB20474 11139239 T to A
FTB20475 11391128 T to C
FTB20476 10877969 C to T
FTB20477 10907464 C to T
FTB20478 11070132 G to A
FTB20479 11094168 C to T
FTB20480 10749579 C to T
FTB20481 10198877 C to T
FTB20482 11667083 C to T
FTB20483 26651856 G to A
FTB20484 6542765 A to C
FTB20485 10173998 G to A
FTB20486 15800514 C to A
FTB20487 17311841 C to T
FTB20488 22237478 CA to C
FTB20489 26432308 G to A
FTB20490 16902209 G to T
FTB20491 15048082 T to C
FTB20492 16733932 C to G
FTB20493 8954843 G to C
FTB20494 16885074 A to G
FTB20495 26625440 T to G
FTB20496 9563501 A to G
FTB20497 20296613 A to C
FTB20498 11436090 G to T
FTB20499 10140848 G to A
FTB20500 10943157 C to T
FTB20501 11030989 C to G
FTB20502 10947774 T to C
FTB20503 11434764 T to G
FTB20504 10992883 A to T
FTB20505 11028090 C to T
FTB20506 20066811 C to G
FTB20507 11551279 A to T
FTB20508 10184596 C to T
FTB20509 20126856 T to G
FTB20510 10946180 A to C
FTB20511 10975430 C to T
FTB20512 11016526 A to T
FTB20513 11153445 G to T
FTB20514 11467174 T to C
FTB20515 11648553 G to A
FTB20516 17241808 T to C
FTB20517 11080623 G to T
FTB20518 7846981 G to T
FTB20519 10216766 G to A
FTB20520 11495011 T to G
FTB20521 11458545 A to T
FTB20522 5735804 T to G
FTB20523 10243583 G to C
FTB20524 14578215 A to T
FTB20525 6841158 T to C
FTB20526 17097909 A to G
FTB20527 8489461 TAT to T
FTB20528 2977066 A to C
FTB20529 4417928 T to C
FTB20530 11420824 C to T
FTB20531 10774766 C to T
FTB20532 4825124 A to T
FTB20533 5183212 T to C
FTB20534 5875615 T to C
FTB20535 11106953 C to T
FTB20536 11438530 C to G
FTB20537 11745888 G to T
FTB20538 26630579 C to T
FTB20539 7298835 A to G
FTB20540 2815148 C to T
FTB20541 7030868 C to T
FTB20542 7419789 G to T
FTB20543 7508688 G to C
FTB20544 7878888 A to G
FTB20545 8246441 A to G
FTB20546 9328846 C to T
FTB20547 11836237 G to A
FTB20548 11850192 A to C
FTB20549 12478911 T to C
FTB20550 12483694 C to T
FTB20551 12579847 G to T
FTB20552 12762602 A to T
FTB20553 12785790 A to G
FTB20554 12979532 G to A
FTB20555 13054057 T to G
FTB20556 13335218 T to A
FTB20557 13632908 T to G
FTB20558 14113036 C to A
FTB20559 14129676 C to G
FTB20560 14170476 G to A
FTB20561 14442186 C to T
FTB20562 14711287 G to A
FTB20563 15234717 C to T
FTB20564 15318005 A to G
FTB20565 15469100 G to C
FTB20566 15762458 A to G
FTB20567 15838704 G to T
FTB20568 16034799 G to T
FTB20569 16041681 G to A
FTB20570 16486209 G to T
FTB20571 16806788 C to G
FTB20572 19093991 C to G
FTB20573 19865940 A to C
FTB20574 19940668 C to A
FTB20575 20005927 G to A
FTB20576 20509696 T to C
FTB20577 20940208 A to G
FTB20578 21099974 T to C
FTB20579 21252326 A to C
FTB20580 21640023 A to G
FTB20581 26593779 C to T
FTB20582 3047548 T to A
FTB20583 3052755 A to G
FTB20584 3056397 C to G
FTB20585 3100718 G to T
FTB20586 3101994 A to T
FTB20587 3106170 G to T
FTB20588 3121328 T to C
FTB20589 3121330 T to C
FTB20590 3126420 A to G
FTB20591 3130566 T to G
FTB20592 3137511 T to C
FTB20593 3139576 T to C
FTB20594 3141310 T to A
FTB20595 3147275 G to A
FTB20596 3150004 A to T
FTB20597 3179307 A to G
FTB20598 3204772 G to A
FTB20599 3210023 C to T
FTB20600 3239232 A to G
FTB20601 3260935 G to C
FTB20602 3265727 T to C
FTB20603 3266904 G to T
FTB20604 3267769 T to C
FTB20605 3273734 G to A
FTB20606 3280141 A to G
FTB20607 3286216 C to T
FTB20608 3300502 C to T
FTB20609 3326472 C to T
FTB20610 3352918 G to T
FTB20611 3375981 T to C
FTB20612 3377757 A to G
FTB20613 3381434 T to C
FTB20614 3388971 G to A
FTB20615 3389360 A to G
FTB20616 3393713 G to C
FTB20617 3397653 G to A
FTB20618 3402372 G to A
FTB20619 3404203 G to C
FTB20620 3416629 T to C
FTB20621 3426205 G to C
FTB20622 3443099 G to T
FTB20623 3443612 C to T
FTB20624 3450983 T to G
FTB20625 3453962 T to C
FTB20626 3459306 A to G
FTB20627 3461853 A to T
FTB20628 3461855 A to G
FTB20629 3466215 C to T
FTB20630 3479819 C to T
FTB20631 3479879 G to T
FTB20632 3499104 A to C
FTB20633 3510203 G to A
FTB20634 3514061 G to A
FTB20635 3540452 C to T
FTB20636 3542098 A to G
FTB20637 3556927 C to A
FTB20638 3558470 G to T
FTB20639 3560031 T to A
FTB20640 3564395 G to C
FTB20641 3569692 T to C
FTB20642 3575071 C to T
FTB20643 3575523 C to T
FTB20644 3576022 T to G
FTB20645 3581675 T to C
FTB20646 3628900 C to G
FTB20647 3632812 T to C
FTB20648 3640308 C to A
FTB20649 3651444 C to T
FTB20650 3652091 A to G
FTB20651 3659714 A to G
FTB20652 3675694 C to G
FTB20653 3676238 C to T
FTB20654 3676623 C to T
FTB20655 3684241 G to T
FTB20656 3686387 C to T
FTB20657 3688709 G to A
FTB20658 3712700 G to A
FTB20659 3714117 T to C
FTB20660 3720667 T to C
FTB20661 3722822 G to A
FTB20662 3736433 T to C
FTB20663 3741211 A to G
FTB20664 3760370 G to A
FTB20665 3790934 C to G
FTB20666 3809676 A to G
FTB20667 3823235 C to T
FTB20668 3825047 G to A
FTB20669 3833579 A to C
FTB20670 3858528 G to A
FTB20671 3858535 G to A
FTB20672 3901221 C to A
FTB20673 3903858 T to G
FTB20674 3906047 A to G
FTB20675 3908420 A to G
FTB20676 3919875 G to A
FTB20677 3923020 A to G
FTB20678 3933966 A to G
FTB20679 3942630 G to A
FTB20680 3942735 T to A
FTB20681 3946040 T to C
FTB20682 3950089 C to T
FTB20683 3962909 A to G
FTB20684 3978691 C to T
FTB20685 3981295 G to A
FTB20686 3981372 A to G
FTB20687 4011515 G to A
FTB20688 4011652 C to T
FTB20689 4020639 C to T
FTB20690 4049567 T to C
FTB20691 4052428 A to C
FTB20692 4081950 T to A
FTB20693 4091370 A to G
FTB20694 4097400 T to G
FTB20695 4100326 T to G
FTB20696 4107670 C to T
FTB20697 4110978 T to C
FTB20698 4115992 G to A
FTB20699 4131876 A to C
FTB20700 4142485 C to G
FTB20701 4151044 C to T
FTB20702 4160383 G to T
FTB20703 4172826 G to A
FTB20704 4179134 G to C
FTB20705 4188259 A to G
FTB20706 4197393 G to T
FTB20707 4205716 T to C
FTB20708 4211075 G to A
FTB20709 4213459 C to T
FTB20710 4220924 C to T
FTB20711 4233950 G to A
FTB20712 4240236 T to A
FTB20713 4254856 C to A
FTB20714 4255117 C to T
FTB20715 4284332 T to G
FTB20716 4297460 C to A
FTB20717 4305017 G to A
FTB20718 4314768 A to G
FTB20719 4323318 A to G
FTB20720 4333705 A to G
FTB20721 4345845 G to C
FTB20722 4361544 T to A
FTB20723 4365350 G to C
FTB20724 4375415 A to G
FTB20725 4382738 A to G
FTB20726 4387473 G to A
FTB20727 4403222 G to A
FTB20728 4406889 T to C
FTB20729 4408400 C to A
FTB20730 4424858 A to T
FTB20731 4448466 C to A
FTB20732 4460223 T to C
FTB20733 4486704 T to A
FTB20734 4492679 C to A
FTB20735 4492685 A to T
FTB20736 4492690 A to T
FTB20737 4492695 A to T
FTB20738 4496743 A to G
FTB20739 4517625 T to C
FTB20740 4523943 C to A
FTB20741 4527384 G to C
FTB20742 4527609 G to A
FTB20743 4533841 A to G
FTB20744 4544612 T to G
FTB20745 4549433 T to C
FTB20746 4567692 T to C
FTB20747 4575016 A to G
FTB20748 4575234 C to G
FTB20749 4586065 T to G
FTB20750 4587351 A to G
FTB20751 4631067 C to T
FTB20752 4632101 C to G
FTB20753 4645848 C to A
FTB20754 4653569 T to C
FTB20755 4654467 G to C
FTB20756 4659197 A to G
FTB20757 4661702 A to G
FTB20758 4666574 T to C
FTB20759 4679021 A to C
FTB20760 4694151 T to C
FTB20761 4721910 C to A
FTB20762 4733576 T to A
FTB20763 4757252 T to A
FTB20764 4760391 C to A
FTB20765 4782810 C to T
FTB20766 4787759 G to A
FTB20767 4787824 G to A
FTB20768 4793802 G to C
FTB20769 4799892 C to A
FTB20770 4801503 G to C
FTB20771 4822643 T to C
FTB20772 4825385 G to T
FTB20773 4837931 A to G
FTB20774 4840850 A to T
FTB20775 4847980 C to A
FTB20776 4850785 A to T
FTB20777 4851600 G to A
FTB20778 4865551 T to G
FTB20779 4875284 A to G
FTB20780 4886923 T to C
FTB20781 4911244 G to T
FTB20782 4918282 C to G
FTB20783 4928686 T to A
FTB20784 4944259 A to C
FTB20785 4945738 T to A
FTB20786 4945763 G to C
FTB20787 4946478 T to C
FTB20788 4962958 A to G
FTB20789 4968717 C to G
FTB20790 4969874 A to G
FTB20791 4988641 G to A
FTB20792 4992316 T to G
FTB20793 4994997 T to C
FTB20794 5013696 A to G
FTB20795 5032086 G to A
FTB20796 5040125 A to T
FTB20797 5069124 G to C
FTB20798 5073779 T to G
FTB20799 5085736 G to A
FTB20800 5093058 A to G
FTB20801 5097234 T to C
FTB20802 5102862 A to G
FTB20803 5107063 C to T
FTB20804 5129980 C to T
FTB20805 5134646 A to G
FTB20806 5139239 C to G
FTB20807 5158208 C to T
FTB20808 5164758 T to C
FTB20809 5191005 C to T
FTB20810 5192220 C to T
FTB20811 5210057 G to A
FTB20812 5226729 C to T
FTB20813 5241715 A to T
FTB20814 5252517 A to G
FTB20815 5272372 T to G
FTB20816 5272622 A to G
FTB20817 5275312 A to G
FTB20818 5301524 T to C
FTB20819 5303900 T to C
FTB20820 5311390 T to C
FTB20821 5320351 G to A
FTB20822 5321904 C to T
FTB20823 5334416 A to C
FTB20824 5350065 T to G
FTB20825 5375617 G to C
FTB20826 5381858 A to T
FTB20827 5382393 A to C
FTB20828 5384177 A to G
FTB20829 5401602 C to T
FTB20830 5406470 C to T
FTB20831 5410324 C to A
FTB20832 5414537 A to T
FTB20833 5428944 A to G
FTB20834 5447461 G to T
FTB20835 5459609 C to A
FTB20836 5462023 T to C
FTB20837 5465433 G to A
FTB20838 5466641 C to G
FTB20839 5469303 A to T
FTB20840 5471543 C to T
FTB20841 5498328 A to G
FTB20842 5512870 C to A
FTB20843 5514494 C to A
FTB20844 5527005 G to C
FTB20845 5532372 T to G
FTB20846 5533052 C to T
FTB20847 5541464 T to C
FTB20848 5554336 A to G
FTB20849 5564443 T to C
FTB20850 5604184 G to A
FTB20851 5614636 C to A
FTB20852 5645578 G to A
FTB20853 5666219 A to C
FTB20854 5679486 C to A
FTB20855 5684084 A to G
FTB20856 5707673 G to T
FTB20857 5707951 A to G
FTB20858 5720597 A to G
FTB20859 5755797 A to G
FTB20860 5761742 G to A
FTB20861 5768819 G to A
FTB20862 5773153 A to G
FTB20863 5778114 A to C
FTB20864 5785263 C to T
FTB20865 5793355 A to G
FTB20866 5795179 G to A
FTB20867 5795990 A to T
FTB20868 5797192 G to A
FTB20869 5806990 T to G
FTB20870 5807756 A to G
FTB20871 5814544 C to T
FTB20872 5822011 T to C
FTB20873 5825577 G to A
FTB20874 5827656 T to G
FTB20875 5841860 A to C
FTB20876 5882985 G to T
FTB20877 5894740 A to G
FTB20878 5895356 T to G
FTB20879 5917175 T to C
FTB20880 5926444 C to T
FTB20881 5940194 C to T
FTB20882 5960832 C to T
FTB20883 5962429 T to C
FTB20884 5962636 C to G
FTB20885 5962940 T to C
FTB20886 5964335 A to C
FTB20887 5977326 G to T
FTB20888 5982532 T to C
FTB20889 5985898 G to C
FTB20890 5999396 C to G
FTB20891 6010486 G to A
FTB20892 6010751 A to G
FTB20893 6019688 G to A
FTB20894 6040007 T to A
FTB20895 6050277 T to A
FTB20896 6050779 A to G
FTB20897 6051820 T to C
FTB20898 6069515 C to T
FTB20899 6071771 G to C
FTB20900 6075490 C to A
FTB20901 6077197 T to C
FTB20902 6085771 A to G
FTB20903 6097942 G to C
FTB20904 6115583 T to C
FTB20905 6118549 C to T
FTB20906 6122507 T to G
FTB20907 6123903 A to C
FTB20908 6161272 G to A
FTB20909 6163324 G to A
FTB20910 6188043 A to G
FTB20911 6190308 T to G
FTB20912 6194743 T to A
FTB20913 6199067 G to T
FTB20914 6208008 T to C
FTB20915 6211203 T to G
FTB20916 6270873 G to C
FTB20917 6277060 A to G
FTB20918 6442743 G to T
FTB20919 6478273 A to G
FTB20920 6482430 A to G
FTB20921 6490486 T to C
FTB20922 6509269 A to G
FTB20923 6514915 G to T
FTB20924 6532655 T to A
FTB20925 6532805 T to C
FTB20926 6533922 C to A
FTB20927 6542408 A to G
FTB20928 6550004 G to A
FTB20929 6570307 T to C
FTB20930 6579902 T to C
FTB20931 6588169 G to A
FTB20932 6589366 A to T
FTB20933 6590390 C to T
FTB20934 6598574 T to A
FTB20935 6599865 C to T
FTB20936 6601137 C to T
FTB20937 6616605 A to G
FTB20938 6619685 G to T
FTB20939 6641101 T to C
FTB20940 6663715 T to A
FTB20941 6673644 T to G
FTB20942 6711402 T to C
FTB20943 6712843 A to C
FTB20944 6715009 G to A
FTB20945 6730260 C to T
FTB20946 6746961 T to C
FTB20947 7062583 C to G
FTB20948 7451187 T to C
FTB20949 9537319 C to T
FTB20950 9553430 T to C
FTB20951 9553903 A to G
FTB20952 9625681 G to A
FTB20953 9626051 C to A
FTB20954 9640170 C to G
FTB20955 9654208 A to T
FTB20956 9679459 T to C
FTB20957 9684282 C to T
FTB20958 9901943 G to A
FTB20959 9924599 T to A
FTB20960 9933769 T to C
FTB20961 9938078 T to C
FTB20962 9958835 G to A
FTB20963 10063573 T to C
FTB20964 11692764 T to G
FTB20965 11719774 G to A
FTB20966 11722440 G to A
FTB20967 11722869 G to T
FTB20968 11723526 A to T
FTB20969 11725950 A to T
FTB20970 11730680 G to A
FTB20971 11740018 G to T
FTB20972 11742148 G to T
FTB20973 15883729 A to G
FTB20974 16204784 G to A
FTB20975 16407471 C to G
FTB20976 16410542 C to T
FTB20977 20351279 G to C
FTB20978 20352762 T to A
FTB20979 21480436 A to G
FTB20980 21481571 A to G
FTB20981 21493158 A to G
FTB20982 21572889 G to A
FTB20983 21751709 G to A
FTB20984 21807145 A to G
FTB20985 21808335 C to A
FTB20986 22218821 A to T
FTB20987 22335187 G to A
FTB20988 22369948 A to G
FTB20989 11350382 G to A
FTB20990 11379042 G to A
FTB20991 20279956 T to A
FTB20992 20270917 T to C
FTB20993 20484011 G to T
FTB20994 20693698 G to A
FTB20995 20872466 G to A
FTB20996 10805137 C to T
FTB20997 10828284 G to A
FTB20998 10994336 C to G
FTB20999 11081432 A to G
FTB21000 11411838 A to C
FTB21001 11446366 A to C
FTB21002 11525736 A to G
FTB21003 11644631 T to A
FTB21004 10983352 A to T
FTB21005 11204657 G to T
FTB21006 16959732 C to A
FTB21007 26627826 G to T
FTB21008 10898899 G to A
FTB21009 10952137 C to T
FTB21010 11399905 G to T
FTB21011 26665439 C to T
FTB21012 16157524 AGA to A
FTB21013 20279947 C to A
FTB21014 3262720 T to A
FTB21015 26435550 G to A
FTB21016 5220552 T to C
FTB21017 12269904 T to C
FTB21018 10246182 G to A
FTB21019 16985371 G to A
FTB21020 2872419 T to C
FTB21021 13967501 C to G
FTB21022 14106147 T to C
FTB21023 10935342 C to T
FTB21024 11079087 G to T
FTB21025 11664835 C to T
FTB21026 10954524 T to A
FTB21027 11481389 C to T
FTB21028 20111354 C to G
FTB21029 10991755 C to T
FTB21030 11069548 C to A
FTB21031 10941483 A to T
FTB21032 6145648 G to A
FTB21033 5259931 C to T
FTB21034 11470337 C to A
FTB21035 13242568 AA to A
FTB21036 11308096 G to A
FTB21037 19288679 C to A
FTB21038 11202222 T to C
FTB21039 11378978 C to G
FTB21040 20307908 G to A
FTB21041 10176987 G to A
FTB21042 10158609 G to A
FTB21043 10900252 G to A
FTB21044 10928380 T to G
FTB21045 12800314 AAGGCTTGCTGCCATCTTTGGA to A
FTB21046 16931887 A to G
FTB21047 19408957 GG to G
FTB21048 11488277 A to T
FTB21049 20788484 T to TT
FTB21050 10783577 A to C
FTB21051 4480323 G to A
FTB21052 9335742 C to T
FTB21053 10138718 G to A
FTB21054 16790780 C to A
FTB21055 21627464 CA to C
FTB21056 12568956 AA to A
FTB21057 15426410 G to T
FTB21058 15712327 TT to T
FTB21059 5239248 A to T
FTB21060 20847928 G to T
FTB21061 20821962 C to T
FTB21062 20939893 C to T
FTB21063 4118190 G to T
FTB21064 20722603 T to C
FTB21065 4554190 G to A
FTB21066 10770998 G to A
FTB21067 13571549 T to C
FTB21068 13571556 C to A
FTB21069 13571558 A to C
FTB21070 11042155 A to G
FTB21071 6597305 TA to T
FTB21072 5377820 G to A
FTB21073 3578348 C to G
FTB21074 6177119 C to T
FTB21075 7470252 A to G
FTB21076 8204407 A to T
FTB21077 12184506 C to A
FTB21078 12570536 A to T
FTB21079 14133241 C to T
FTB21080 14478769 T to A
FTB21081 16518929 C to T
FTB21082 17410132 G to A
FTB21083 19391554 C to T
FTB21084 20618198 T to C
FTB21085 20849285 G to A
FTB21086 21046130 C to T
FTB21087 26432146 T to A
FTB21088 26449706 G to C
FTB21089 2790825 G to T
FTB21090 2804171 T to C
FTB21091 2804538 A to C
FTB21092 2806500 C to A
FTB21093 2809661 G to C
FTB21094 2811841 A to G
FTB21095 2830158 G to A
FTB21096 2831173 T to A
FTB21097 2840397 G to A
FTB21098 2840730 C to A
FTB21099 2905295 C to T
FTB21100 2921981 G to T
FTB21101 3027450 A to G
FTB21102 3028539 C to T
FTB21103 3030038 G to C
FTB21104 3031042 C to G
FTB21105 3032203 G to A
FTB21106 6748741 T to C
FTB21107 6756778 G to A
FTB21108 6774516 A to C
FTB21109 6795683 G to T
FTB21110 6819106 A to C
FTB21111 6819110 C to T
FTB21112 6825715 C to T
FTB21113 6842347 G to A
FTB21114 6884279 C to T
FTB21115 6902996 A to G
FTB21116 7021479 A to G
FTB21117 7034511 C to G
FTB21118 7054756 C to G
FTB21119 7060609 A to G
FTB21120 7060616 A to G
FTB21121 7060638 G to C
FTB21122 7061855 C to A
FTB21123 7138886 C to T
FTB21124 7149920 A to C
FTB21125 7152943 A to G
FTB21126 7156359 A to T
FTB21127 7156892 A to G
FTB21128 7157793 T to G
FTB21129 7158530 A to G
FTB21130 7158535 T to G
FTB21131 7159186 C to T
FTB21132 7159760 T to C
FTB21133 7160530 G to T
FTB21134 7163285 A to G
FTB21135 7164040 C to G
FTB21136 7164869 G to T
FTB21137 7171343 G to A
FTB21138 7177356 A to C
FTB21139 7230590 G to A
FTB21140 7247707 A to G
FTB21141 7250580 T to C
FTB21142 7251265 G to C
FTB21143 7255415 C to A
FTB21144 7259964 G to A
FTB21145 7270453 G to A
FTB21146 7270687 G to A
FTB21147 7280809 C to T
FTB21148 7281385 C to T
FTB21149 7298273 C to A
FTB21150 7299097 G to T
FTB21151 7307408 A to G
FTB21152 7318443 A to G
FTB21153 7354179 A to G
FTB21154 7368490 C to A
FTB21155 7369030 G to T
FTB21156 7381911 T to C
FTB21157 7387772 G to T
FTB21158 7473999 G to A
FTB21159 7494509 C to T
FTB21160 7494836 G to A
FTB21161 7502442 G to A
FTB21162 7506294 C to A
FTB21163 7512396 C to T
FTB21164 7517309 T to C
FTB21165 7525502 A to G
FTB21166 7567239 T to G
FTB21167 7569046 C to T
FTB21168 7572219 G to A
FTB21169 7572224 A to G
FTB21170 7573687 A to G
FTB21171 7574521 G to T
FTB21172 7574993 T to G
FTB21173 7575307 G to A
FTB21174 7576857 A to C
FTB21175 7584860 T to G
FTB21176 7613286 A to G
FTB21177 7645344 G to A
FTB21178 7705209 A to G
FTB21179 7837123 A to G
FTB21180 7876745 C to A
FTB21181 8006042 A to G
FTB21182 8028146 A to C
FTB21183 8028339 G to C
FTB21184 8028662 C to T
FTB21185 8029269 A to C
FTB21186 8055895 G to T
FTB21187 8098424 C to T
FTB21188 8116846 T to G
FTB21189 8136844 A to G
FTB21190 8138080 T to G
FTB21191 8138091 T to C
FTB21192 8138688 T to C
FTB21193 8138950 T to G
FTB21194 8138966 G to T
FTB21195 8139237 A to C
FTB21196 8139238 G to A
FTB21197 8139424 A to G
FTB21198 8196641 C to A
FTB21199 8196998 C to T
FTB21200 8204073 G to A
FTB21201 8347909 C to A
FTB21202 8368675 C to T
FTB21203 8409533 C to T
FTB21204 8613611 C to T
FTB21205 8803764 G to C
FTB21206 8824396 A to G
FTB21207 8892642 G to A
FTB21208 8939098 T to G
FTB21209 8944757 C to T
FTB21210 8946186 G to C
FTB21211 8956662 A to G
FTB21212 9016727 T to G
FTB21213 9129671 G to A
FTB21214 9137522 A to G
FTB21215 9146186 C to T
FTB21216 9148325 C to G
FTB21217 9194841 A to T
FTB21218 9194978 T to C
FTB21219 9196687 G to A
FTB21220 9203239 G to A
FTB21221 9205306 T to C
FTB21222 9239987 C to G
FTB21223 9318988 T to C
FTB21224 9320304 T to A
FTB21225 9321485 A to G
FTB21226 9323118 G to A
FTB21227 9325608 T to G
FTB21228 9326637 T to C
FTB21229 9330611 T to C
FTB21230 9333062 T to C
FTB21231 9333669 A to C
FTB21232 9575711 G to A
FTB21233 9594898 C to A
FTB21234 9596508 T to C
FTB21235 9969445 T to G
FTB21236 9988225 A to G
FTB21237 10051970 C to A
FTB21238 10060306 C to A
FTB21239 10061854 G to A
FTB21240 10062109 G to T
FTB21241 11753716 A to G
FTB21242 11757420 A to G
FTB21243 11757562 C to T
FTB21244 11758783 A to C
FTB21245 11764719 G to T
FTB21246 11766404 A to G
FTB21247 11786389 C to T
FTB21248 11788975 G to A
FTB21249 11794651 C to A
FTB21250 11807526 A to T
FTB21251 11808488 T to C
FTB21252 11816105 A to T
FTB21253 11824852 A to T
FTB21254 11826734 C to T
FTB21255 11840933 A to C
FTB21256 11844668 T to A
FTB21257 11855225 G to T
FTB21258 11855233 T to A
FTB21259 11857294 C to T
FTB21260 11857690 T to A
FTB21261 11858879 G to A
FTB21262 11859103 T to C
FTB21263 11859578 G to A
FTB21264 11862691 C to T
FTB21265 11873967 C to A
FTB21266 11893936 C to T
FTB21267 11920639 T to C
FTB21268 11932954 G to T
FTB21269 11936572 C to T
FTB21270 11955157 C to A
FTB21271 11955957 C to G
FTB21272 11968861 T to A
FTB21273 11986210 C to T
FTB21274 11993987 A to G
FTB21275 11993995 T to C
FTB21276 12001505 G to T
FTB21277 12002326 G to C
FTB21278 12007982 A to T
FTB21279 12009420 C to G
FTB21280 12012670 T to A
FTB21281 12013946 G to T
FTB21282 12014255 G to T
FTB21283 12035497 G to C
FTB21284 12040679 T to A
FTB21285 12042879 A to G
FTB21286 12042963 T to C
FTB21287 12044242 C to G
FTB21288 12074786 G to A
FTB21289 12083870 A to T
FTB21290 12137401 C to T
FTB21291 12139111 C to A
FTB21292 12140361 A to T
FTB21293 12163475 A to T
FTB21294 12182101 C to G
FTB21295 12183792 C to A
FTB21296 12185961 C to A
FTB21297 12187259 A to G
FTB21298 12220875 C to A
FTB21299 12237458 C to A
FTB21300 12266244 G to T
FTB21301 12311871 T to A
FTB21302 12311985 T to G
FTB21303 12316348 G to A
FTB21304 12318588 C to A
FTB21305 12318859 A to G
FTB21306 12319477 A to G
FTB21307 12359792 C to A
FTB21308 12381049 C to T
FTB21309 12398483 A to G
FTB21310 12400658 C to T
FTB21311 12403106 G to A
FTB21312 12445692 T to C
FTB21313 12451643 A to G
FTB21314 12502957 C to T
FTB21315 12503698 G to A
FTB21316 12505057 T to C
FTB21317 12506088 G to T
FTB21318 12508634 C to T
FTB21319 12536987 G to A
FTB21320 12558591 A to G
FTB21321 12559253 G to T
FTB21322 12571114 T to C
FTB21323 12571310 G to A
FTB21324 12571943 G to A
FTB21325 12575650 C to T
FTB21326 12575741 T to C
FTB21327 12576023 A to G
FTB21328 12647562 C to T
FTB21329 12683072 A to G
FTB21330 12848379 A to T
FTB21331 12850377 G to C
FTB21332 12989502 A to G
FTB21333 12996240 C to G
FTB21334 13005134 C to T
FTB21335 13035723 A to G
FTB21336 13058799 C to G
FTB21337 13109208 C to T
FTB21338 13119310 T to G
FTB21339 13119443 C to G
FTB21340 13130293 T to A
FTB21341 13131843 G to C
FTB21342 13131888 C to G
FTB21343 13132336 T to C
FTB21344 13135822 C to G
FTB21345 13135871 C to G
FTB21346 13175238 A to C
FTB21347 13177116 T to A
FTB21348 13182632 C to T
FTB21349 13182913 T to C
FTB21350 13183045 C to T
FTB21351 13183251 C to T
FTB21352 13183756 G to T
FTB21353 13184287 G to T
FTB21354 13184922 G to A
FTB21355 13188799 A to G
FTB21356 13221863 G to T
FTB21357 13256566 T to C
FTB21358 13257176 C to T
FTB21359 13258343 G to C
FTB21360 13265707 T to C
FTB21361 13266539 G to T
FTB21362 13289155 A to G
FTB21363 13330920 G to A
FTB21364 13487367 G to A
FTB21365 13515146 G to T
FTB21366 13519016 A to T
FTB21367 13524357 C to T
FTB21368 13524609 C to T
FTB21369 13525732 T to C
FTB21370 13527338 C to A
FTB21371 13527543 T to C
FTB21372 13528559 T to C
FTB21373 13528565 A to G
FTB21374 13535670 G to T
FTB21375 13535717 T to G
FTB21376 13559519 C to T
FTB21377 13559916 C to G
FTB21378 13561675 A to T
FTB21379 13568629 C to G
FTB21380 13571567 C to T
FTB21381 13620836 G to A
FTB21382 13631567 A to G
FTB21383 13637192 C to A
FTB21384 13647427 A to G
FTB21385 13661911 C to T
FTB21386 13678899 A to G
FTB21387 13683031 G to A
FTB21388 13692659 A to T
FTB21389 13693239 T to A
FTB21390 13725582 T to G
FTB21391 13726183 T to C
FTB21392 13727426 C to G
FTB21393 13744439 T to G
FTB21394 13745207 G to C
FTB21395 13745324 A to G
FTB21396 13753051 G to C
FTB21397 13772453 T to C
FTB21398 13772493 G to T
FTB21399 13772667 G to A
FTB21400 13772920 C to G
FTB21401 13772943 T to C
FTB21402 13779085 G to A
FTB21403 13807495 C to T
FTB21404 13809788 G to C
FTB21405 13810913 A to G
FTB21406 13824054 C to A
FTB21407 13831665 C to T
FTB21408 13847519 A to G
FTB21409 13848041 T to C
FTB21410 13889072 G to A
FTB21411 13889943 C to A
FTB21412 13898851 C to T
FTB21413 13901804 C to T
FTB21414 13912644 G to A
FTB21415 13916850 A to G
FTB21416 13932594 G to A
FTB21417 13936341 T to C
FTB21418 13944308 C to T
FTB21419 13956692 G to C
FTB21420 13956707 G to T
FTB21421 13957583 G to C
FTB21422 13963845 G to T
FTB21423 13963868 A to C
FTB21424 13969450 G to A
FTB21425 13969789 T to G
FTB21426 13970458 T to G
FTB21427 13978299 G to A
FTB21428 13981737 T to C
FTB21429 13982091 C to A
FTB21430 13983015 C to T
FTB21431 13983233 G to C
FTB21432 14067490 C to G
FTB21433 14069879 T to C
FTB21434 14072558 G to T
FTB21435 14083205 G to A
FTB21436 14098038 C to T
FTB21437 14102898 C to T
FTB21438 14103307 G to T
FTB21439 14104025 C to T
FTB21440 14160747 C to A
FTB21441 14166603 C to T
FTB21442 14209348 C to T
FTB21443 14211389 C to T
FTB21444 14242523 T to A
FTB21445 14284572 A to G
FTB21446 14311555 G to A
FTB21447 14312470 A to T
FTB21448 14314177 C to T
FTB21449 14352852 T to C
FTB21450 14357138 G to C
FTB21451 14357768 A to G
FTB21452 14368770 T to A
FTB21453 14386396 A to T
FTB21454 14386403 G to A
FTB21455 14390264 G to C
FTB21456 14390865 G to A
FTB21457 14391372 C to T
FTB21458 14410902 C to A
FTB21459 14461294 C to A
FTB21460 14475616 G to A
FTB21461 14491069 G to T
FTB21462 14507608 T to G
FTB21463 14553199 G to A
FTB21464 14564850 A to G
FTB21465 14572938 G to T
FTB21466 14592301 A to G
FTB21467 14592786 T to A
FTB21468 14592795 A to G
FTB21469 14593600 G to T
FTB21470 14597063 T to C
FTB21471 14597426 G to C
FTB21472 14597537 T to G
FTB21473 14598135 C to A
FTB21474 14608005 C to G
FTB21475 14608493 T to A
FTB21476 14610426 A to G
FTB21477 14612382 G to C
FTB21478 14615886 G to T
FTB21479 14673153 G to A
FTB21480 14703207 C to T
FTB21481 14703378 C to T
FTB21482 14703925 A to G
FTB21483 14704179 A to G
FTB21484 14730747 C to T
FTB21485 14818396 G to A
FTB21486 14833015 G to A
FTB21487 14859878 G to T
FTB21488 14861507 G to A
FTB21489 14863953 A to C
FTB21490 14864543 G to T
FTB21491 14912957 G to A
FTB21492 14924045 T to A
FTB21493 14946426 G to A
FTB21494 14947336 C to T
FTB21495 14948777 T to C
FTB21496 14950899 A to G
FTB21497 14956036 A to C
FTB21498 14957147 G to T
FTB21499 14957191 C to T
FTB21500 14973327 C to G
FTB21501 14984641 G to A
FTB21502 15004432 T to A
FTB21503 15011231 G to A
FTB21504 15012680 G to T
FTB21505 15048112 C to G
FTB21506 15049190 G to A
FTB21507 15052105 C to G
FTB21508 15069920 A to C
FTB21509 15116729 A to T
FTB21510 15118924 A to G
FTB21511 15133734 G to A
FTB21512 15134735 G to A
FTB21513 15145991 C to T
FTB21514 15146380 G to A
FTB21515 15147833 G to A
FTB21516 15148097 A to G
FTB21517 15148275 A to T
FTB21518 15148424 T to A
FTB21519 15148578 C to G
FTB21520 15149741 C to G
FTB21521 15154257 G to A
FTB21522 15155791 T to C
FTB21523 15264054 T to G
FTB21524 15264970 T to C
FTB21525 15265712 A to G
FTB21526 15266422 C to A
FTB21527 15278203 G to T
FTB21528 15316700 C to A
FTB21529 15320053 A to C
FTB21530 15321180 T to C
FTB21531 15337981 T to G
FTB21532 15385272 C to G
FTB21533 15387248 C to T
FTB21534 15387509 G to C
FTB21535 15389552 C to T
FTB21536 15391174 G to A
FTB21537 15411525 C to A
FTB21538 15428267 G to C
FTB21539 15430297 A to T
FTB21540 15431174 G to A
FTB21541 15431198 A to T
FTB21542 15431715 A to G
FTB21543 15434050 G to C
FTB21544 15505926 G to C
FTB21545 15514912 C to G
FTB21546 15523372 A to G
FTB21547 15524169 G to A
FTB21548 15526720 G to A
FTB21549 15531668 G to A
FTB21550 15558780 C to T
FTB21551 15572201 C to T
FTB21552 15572340 G to T
FTB21553 15590230 A to T
FTB21554 15612977 C to T
FTB21555 15616738 C to T
FTB21556 15620096 A to G
FTB21557 15622057 T to G
FTB21558 15628692 A to C
FTB21559 15645174 G to C
FTB21560 15645358 G to T
FTB21561 15670905 T to C
FTB21562 15673217 C to T
FTB21563 15675258 G to A
FTB21564 15675651 A to G
FTB21565 15684245 G to T
FTB21566 15713470 C to T
FTB21567 15716244 T to C
FTB21568 15723518 T to C
FTB21569 15725423 T to C
FTB21570 15725493 G to A
FTB21571 15743695 G to A
FTB21572 15772172 T to C
FTB21573 15786566 T to G
FTB21574 15789744 T to A
FTB21575 15790083 C to A
FTB21576 15871947 C to T
FTB21577 15891221 T to A
FTB21578 15892530 T to C
FTB21579 15893788 A to T
FTB21580 15905619 T to C
FTB21581 15913475 A to C
FTB21582 15915321 A to G
FTB21583 15929491 C to T
FTB21584 15943809 G to A
FTB21585 15944034 C to T
FTB21586 15944544 C to A
FTB21587 15947552 T to C
FTB21588 15977676 T to C
FTB21589 16002077 G to A
FTB21590 16007820 G to A
FTB21591 16008587 T to G
FTB21592 16008753 G to A
FTB21593 16019588 C to T
FTB21594 16023527 C to A
FTB21595 16023592 T to C
FTB21596 16027049 A to G
FTB21597 16027089 T to C
FTB21598 16028557 C to T
FTB21599 16030274 G to A
FTB21600 16030872 C to T
FTB21601 16040507 A to G
FTB21602 16045165 T to A
FTB21603 16045877 G to C
FTB21604 16091316 C to A
FTB21605 16091317 A to T
FTB21606 16117211 A to G
FTB21607 16117396 C to G
FTB21608 16119716 A to T
FTB21609 16144158 C to G
FTB21610 16146546 G to T
FTB21611 16146771 A to G
FTB21612 16153248 C to T
FTB21613 16156253 G to A
FTB21614 16156346 T to C
FTB21615 16274701 C to A
FTB21616 16275167 C to T
FTB21617 16282169 C to T
FTB21618 16288745 C to T
FTB21619 16292265 G to C
FTB21620 16294431 G to A
FTB21621 16296026 T to A
FTB21622 16308413 T to G
FTB21623 16309924 C to A
FTB21624 16312149 C to A
FTB21625 16312540 A to T
FTB21626 16313941 G to A
FTB21627 16314348 C to A
FTB21628 16429840 C to T
FTB21629 16434588 A to G
FTB21630 16437409 G to C
FTB21631 16437432 T to C
FTB21632 16437948 G to C
FTB21633 16439729 G to A
FTB21634 16440339 G to A
FTB21635 16468178 C to A
FTB21636 16514755 G to C
FTB21637 16515833 G to T
FTB21638 16515887 G to A
FTB21639 16525073 G to A
FTB21640 16540975 A to G
FTB21641 16581197 C to T
FTB21642 16621922 T to A
FTB21643 16637389 C to A
FTB21644 16638042 C to A
FTB21645 16678632 G to T
FTB21646 16683911 C to T
FTB21647 16684080 G to T
FTB21648 16685280 A to T
FTB21649 16687890 C to T
FTB21650 16734350 G to A
FTB21651 16741731 C to T
FTB21652 16762690 T to C
FTB21653 16764814 A to G
FTB21654 16847354 A to G
FTB21655 16857476 T to C
FTB21656 16858521 G to A
FTB21657 16858820 C to T
FTB21658 16863300 C to A
FTB21659 16877285 A to G
FTB21660 16878518 A to G
FTB21661 16901671 G to A
FTB21662 16905123 G to T
FTB21663 16913547 A to T
FTB21664 16915595 G to A
FTB21665 16915779 C to T
FTB21666 16917291 C to A
FTB21667 16917657 G to A
FTB21668 16917676 G to A
FTB21669 16918048 G to C
FTB21670 16932404 A to G
FTB21671 16944118 A to G
FTB21672 16950905 G to A
FTB21673 16959977 G to T
FTB21674 16960489 C to T
FTB21675 16961167 A to G
FTB21676 16971890 G to A
FTB21677 16986489 T to C
FTB21678 16987287 C to A
FTB21679 16987978 C to G
FTB21680 16989766 C to T
FTB21681 17035693 C to T
FTB21682 17055415 T to G
FTB21683 17055954 C to A
FTB21684 17066825 C to T
FTB21685 17071569 C to G
FTB21686 17133475 G to C
FTB21687 17136807 C to G
FTB21688 17190811 T to C
FTB21689 17212705 C to T
FTB21690 17215290 C to A
FTB21691 17215802 C to A
FTB21692 17216282 A to C
FTB21693 17217625 T to C
FTB21694 17241457 T to A
FTB21695 17243926 T to C
FTB21696 17252730 A to G
FTB21697 17271679 C to T
FTB21698 17274093 T to C
FTB21699 17304342 A to C
FTB21700 17313666 A to T
FTB21701 17314725 G to C
FTB21702 17322549 G to A
FTB21703 17348494 A to G
FTB21704 17352073 C to T
FTB21705 17355483 C to T
FTB21706 17372065 A to T
FTB21707 17372245 G to A
FTB21708 17373871 A to C
FTB21709 17375721 T to A
FTB21710 17448374 C to T
FTB21711 17450265 T to C
FTB21712 17454008 G to C
FTB21713 18646721 C to G
FTB21714 18649478 A to G
FTB21715 18650858 C to G
FTB21716 18651235 T to A
FTB21717 18652525 G to C
FTB21718 18655023 T to C
FTB21719 18658874 T to G
FTB21720 18676958 G to A
FTB21721 18873880 C to G
FTB21722 18876703 A to T
FTB21723 18881862 C to T
FTB21724 18896651 C to G
FTB21725 18897457 T to C
FTB21726 18899315 G to C
FTB21727 18899339 A to G
FTB21728 18958537 G to A
FTB21729 18963154 C to T
FTB21730 18987950 G to A
FTB21731 18989005 T to G
FTB21732 18992711 T to G
FTB21733 18993374 T to G
FTB21734 19008666 T to C
FTB21735 19008886 G to C
FTB21736 19045669 T to G
FTB21737 19046430 T to C
FTB21738 19046434 T to C
FTB21739 19083161 T to G
FTB21740 19086029 G to A
FTB21741 19095455 T to A
FTB21742 19111118 G to A
FTB21743 19116386 C to A
FTB21744 19163639 A to G
FTB21745 19173274 G to A
FTB21746 19187509 A to G
FTB21747 19217384 T to C
FTB21748 19217719 G to T
FTB21749 19218097 G to T
FTB21750 19218847 C to T
FTB21751 19256370 G to A
FTB21752 19259829 G to A
FTB21753 19273454 C to G
FTB21754 19288275 A to C
FTB21755 19297458 G to T
FTB21756 19302200 G to A
FTB21757 19306158 C to A
FTB21758 19306167 A to C
FTB21759 19335771 T to C
FTB21760 19335851 A to G
FTB21761 19336376 C to T
FTB21762 19349668 A to T
FTB21763 19373153 C to G
FTB21764 19375408 A to T
FTB21765 19375418 G to C
FTB21766 19377068 C to G
FTB21767 19377154 C to T
FTB21768 19377752 A to C
FTB21769 19377864 T to C
FTB21770 19378288 A to C
FTB21771 19378337 C to T
FTB21772 19378461 T to C
FTB21773 19391150 T to C
FTB21774 19391516 G to C
FTB21775 19391802 G to T
FTB21776 19391890 A to T
FTB21777 19414218 C to A
FTB21778 19417733 C to T
FTB21779 19417810 A to G
FTB21780 19421975 A to G
FTB21781 19424000 A to G
FTB21782 19427362 T to A
FTB21783 19438882 C to T
FTB21784 19469173 T to C
FTB21785 19469932 A to T
FTB21786 19508808 C to T
FTB21787 19517359 T to G
FTB21788 19626300 G to A
FTB21789 19626413 T to A
FTB21790 19630989 C to T
FTB21791 19632209 T to A
FTB21792 19641918 C to A
FTB21793 19666389 T to C
FTB21794 19667462 G to A
FTB21795 19668023 T to C
FTB21796 19668949 C to A
FTB21797 19674418 G to A
FTB21798 19678261 T to A
FTB21799 19688602 C to T
FTB21800 19724822 C to T
FTB21801 19725252 G to A
FTB21802 19726093 T to C
FTB21803 19782766 C to T
FTB21804 19806185 C to A
FTB21805 19806714 A to G
FTB21806 19853442 T to A
FTB21807 19890301 C to A
FTB21808 19896204 C to T
FTB21809 19965193 T to C
FTB21810 19992412 C to A
FTB21811 19999678 G to T
FTB21812 20006438 G to A
FTB21813 20020338 C to G
FTB21814 20031369 C to T
FTB21815 20035637 C to T
FTB21816 20043393 G to T
FTB21817 20047555 A to T
FTB21818 20047613 C to T
FTB21819 20047906 T to C
FTB21820 20049844 C to A
FTB21821 20050426 T to G
FTB21822 20054245 G to T
FTB21823 20353515 A to T
FTB21824 20357739 G to T
FTB21825 20357743 G to A
FTB21826 20357785 C to A
FTB21827 20358673 C to T
FTB21828 20359522 G to A
FTB21829 20359682 G to A
FTB21830 20361483 C to T
FTB21831 20363435 A to T
FTB21832 20368299 G to A
FTB21833 20370114 C to T
FTB21834 20370802 A to C
FTB21835 20370880 G to A
FTB21836 20371074 C to T
FTB21837 20371180 T to C
FTB21838 20371459 A to G
FTB21839 20371621 A to C
FTB21840 20371879 C to T
FTB21841 20373079 G to A
FTB21842 20373118 A to G
FTB21843 20373512 T to C
FTB21844 20373520 G to T
FTB21845 20373925 G to T
FTB21846 20375232 G to A
FTB21847 20381265 T to G
FTB21848 20381851 G to C
FTB21849 20432124 G to A
FTB21850 20432163 C to T
FTB21851 20458599 G to A
FTB21852 20459740 C to G
FTB21853 20460452 T to C
FTB21854 20460461 A to G
FTB21855 20461495 C to T
FTB21856 20474105 A to T
FTB21857 20474995 C to A
FTB21858 20476236 C to G
FTB21859 20477257 G to T
FTB21860 20503263 G to C
FTB21861 20506476 A to T
FTB21862 20506561 C to T
FTB21863 20533575 T to A
FTB21864 20605787 T to G
FTB21865 20618151 G to C
FTB21866 20627595 A to G
FTB21867 20637600 A to C
FTB21868 20647265 C to A
FTB21869 20675751 T to C
FTB21870 20676219 G to A
FTB21871 20678028 G to A
FTB21872 20678949 A to G
FTB21873 20690638 T to C
FTB21874 20692145 T to G
FTB21875 20692503 T to A
FTB21876 20693628 A to G
FTB21877 20715298 T to C
FTB21878 20717253 T to C
FTB21879 20720602 T to G
FTB21880 20720605 A to G
FTB21881 20793708 T to C
FTB21882 20818832 C to T
FTB21883 20821160 T to C
FTB21884 20823474 G to C
FTB21885 20845922 T to C
FTB21886 20846299 G to T
FTB21887 20855747 T to C
FTB21888 20858310 A to T
FTB21889 20865270 C to T
FTB21890 20866290 C to T
FTB21891 20866790 G to A
FTB21892 20887809 A to G
FTB21893 20914558 G to A
FTB21894 20915575 C to T
FTB21895 20923800 T to C
FTB21896 20924122 T to C
FTB21897 20924989 C to A
FTB21898 20940889 A to G
FTB21899 20942801 T to G
FTB21900 20944520 T to C
FTB21901 20948628 C to T
FTB21902 20949323 C to T
FTB21903 20959180 C to T
FTB21904 20966161 A to G
FTB21905 20966173 T to G
FTB21906 20996927 T to C
FTB21907 21006675 G to A
FTB21908 21010101 G to A
FTB21909 21027788 C to T
FTB21910 21030377 G to T
FTB21911 21031991 T to A
FTB21912 21036151 C to T
FTB21913 21039773 C to T
FTB21914 21041104 G to T
FTB21915 21047941 C to T
FTB21916 21048292 C to A
FTB21917 21048936 T to C
FTB21918 21064013 G to A
FTB21919 21064136 G to A
FTB21920 21065915 T to A
FTB21921 21065941 A to G
FTB21922 21065946 A to G
FTB21923 21066210 C to T
FTB21924 21066804 G to A
FTB21925 21077844 C to A
FTB21926 21156448 C to G
FTB21927 21199849 G to T
FTB21928 21201031 T to C
FTB21929 21211083 A to T
FTB21930 21279048 A to T
FTB21931 21355379 A to G
FTB21932 21363166 C to T
FTB21933 21392903 A to C
FTB21934 21402420 A to G
FTB21935 21439388 G to A
FTB21936 21623953 G to C
FTB21937 21624224 G to A
FTB21938 21715277 C to G
FTB21939 21716096 C to T
FTB21940 22227995 T to C
FTB21941 22239834 G to C
FTB21942 22243013 T to C
FTB21943 22300307 G to A
FTB21944 26317710 C to T
FTB21945 26326668 G to A
FTB21946 26332224 G to T
FTB21947 26333610 T to G
FTB21948 26341642 C to A
FTB21949 26342464 C to T
FTB21950 26343556 C to T
FTB21951 26344137 T to C
FTB21952 26345873 G to C
FTB21953 26346932 T to C
FTB21954 26356457 T to G
FTB21955 26369715 G to T
FTB21956 26371568 G to T
FTB21957 26380532 T to G
FTB21958 26396763 T to C
FTB21959 26403093 G to A
FTB21960 26405099 T to G
FTB21961 26411420 C to A
FTB21962 26424103 G to T
FTB21963 26426445 G to A
FTB21964 26433350 T to G
FTB21965 26453605 G to A
FTB21966 26455980 G to A
FTB21967 26457961 C to G
FTB21968 26459636 C to T
FTB21969 26463226 A to T
FTB21970 26464625 A to C
FTB21971 26467863 G to A
FTB21972 26481858 T to C
FTB21973 26497740 G to T
FTB21974 26501996 T to A
FTB21975 26509351 C to T
FTB21976 26511115 C to G
FTB21977 26529267 T to A
FTB21978 26534823 A to G
FTB21979 26539055 C to T
FTB21980 26559638 T to C
FTB21981 26568167 C to T
FTB21982 26585811 C to A
FTB21983 26590140 G to A
FTB21984 26592360 T to C
FTB21985 26593135 C to A
FTB21986 26604150 T to C
FTB21987 26618247 T to G
FTB21988 26618847 A to G
FTB21989 3000087 A to G
FTB21990 6851956 G to A
FTB21991 7091506 A to T
FTB21992 7095826 G to T
FTB21993 7398830 A to G
FTB21994 7421060 A to G
FTB21995 7504030 C to G
FTB21996 7516672 G to A
FTB21997 7516689 A to G
FTB21998 7602422 A to G
FTB21999 7886478 C to T
FTB22000 7899202 T to C
FTB22001 7974966 A to C
FTB22002 8041688 C to T
FTB22003 8210650 G to A
FTB22004 8500884 T to C
FTB22005 8582847 A to G
FTB22006 8724982 T to A
FTB22007 8730928 C to T
FTB22008 8819445 A to C
FTB22009 8827479 C to T
FTB22010 8923446 C to T
FTB22011 9035125 C to T
FTB22012 9272290 C to T
FTB22013 10021262 T to C
FTB22014 10047172 A to C
FTB22015 11779575 T to A
FTB22016 11781032 G to A
FTB22017 11815580 A to T
FTB22018 11925141 A to T
FTB22019 11933854 G to C
FTB22020 11970228 C to T
FTB22021 11970680 G to A
FTB22022 12020800 T to C
FTB22023 12055075 C to T
FTB22024 12095460 G to A
FTB22025 12128783 T to A
FTB22026 12188732 G to A
FTB22027 12368104 T to G
FTB22028 12466007 C to G
FTB22029 12576532 C to T
FTB22030 12681453 C to T
FTB22031 12762295 G to T
FTB22032 13095829 A to T
FTB22033 13277397 T to A
FTB22034 13415219 G to A
FTB22035 13544607 G to A
FTB22036 13578624 T to A
FTB22037 13613389 G to T
FTB22038 13618296 C to T
FTB22039 13759436 T to C
FTB22040 14445336 A to G
FTB22041 14485202 C to T
FTB22042 14522806 T to G
FTB22043 14557884 G to A
FTB22044 14629128 A to C
FTB22045 14827509 T to C
FTB22046 14850525 C to T
FTB22047 14970474 C to A
FTB22048 15061203 A to G
FTB22049 15131064 C to T
FTB22050 15244772 T to C
FTB22051 15405229 T to C
FTB22052 15438144 G to T
FTB22053 15495630 A to T
FTB22054 15518589 G to A
FTB22055 15625488 C to A
FTB22056 15707996 T to C
FTB22057 15721887 T to C
FTB22058 15919842 A to G
FTB22059 15923220 T to G
FTB22060 15948990 C to T
FTB22061 15963992 T to G
FTB22062 15993584 C to A
FTB22063 16091544 C to T
FTB22064 16095693 C to T
FTB22065 16273331 C to T
FTB22066 16599057 A to G
FTB22067 16836522 A to G
FTB22068 16865664 A to C
FTB22069 16883381 A to G
FTB22070 17042775 C to T
FTB22071 17086652 A to G
FTB22072 17296468 G to A
FTB22073 17342959 T to A
FTB22074 18668763 T to C
FTB22075 19130771 G to A
FTB22076 19130912 C to T
FTB22077 19323886 G to T
FTB22078 19604157 G to C
FTB22079 19677552 G to A
FTB22080 19706674 G to A
FTB22081 19910133 T to C
FTB22082 19914222 T to C
FTB22083 19930069 A to G
FTB22084 20403234 T to C
FTB22085 20407089 G to C
FTB22086 20510157 A to G
FTB22087 20538277 G to A
FTB22088 20778538 T to A
FTB22089 20875516 G to A
FTB22090 20937580 G to T
FTB22091 20984824 C to T
FTB22092 20987517 G to A
FTB22093 20999586 C to T
FTB22094 21072702 C to T
FTB22095 21317037 C to T
FTB22096 21331898 T to G
FTB22097 21687438 A to G
FTB22098 26320741 C to T
FTB22099 26337627 G to A
FTB22100 26339669 T to C
FTB22101 26399792 C to G
FTB22102 26478251 G to A
FTB22103 26488531 G to A
FTB22104 26517792 C to G
FTB22105 7485488 A to G
FTB22106 8036491 C to T
FTB22107 8257735 A to G
FTB22108 8274686 C to A
FTB22109 8331891 C to T
FTB22110 8363408 C to T
FTB22111 8389184 G to A
FTB22112 11791771 T to A
FTB22113 11798848 G to A
FTB22114 11818983 A to T
FTB22115 11826400 A to G
FTB22116 11832217 A to G
FTB22117 11835560 A to C
FTB22118 11986973 G to A
FTB22119 12234933 G to A
FTB22120 12302227 C to A
FTB22121 12309596 G to A
FTB22122 13160121 A to G
FTB22123 13618132 T to A
FTB22124 13637688 A to G
FTB22125 13903623 C to A
FTB22126 14257853 C to A
FTB22127 14840648 G to T
FTB22128 15127313 A to G
FTB22129 15582706 G to T
FTB22130 17394050 T to G
FTB22131 18640327 A to C
FTB22132 21310159 A to G
FTB22133 21310162 A to G
FTB22134 26353595 G to T
FTB22135 26377722 T to C
FTB22136 26388180 C to A
FTB22137 26496666 C to G
FTB22138 26595810 G to T
FTB22139 26616828 A to G
FTB22140 4702905 G to A
FTB22141 5294287 C to T
FTB22142 6647587 C to G
FTB22143 9540562 C to A
FTB22144 11231452 A to C
FTB22145 11232737 C to T
FTB22146 11417759 A to T
FTB22147 11479578 C to T
FTB22148 11725054 A to G
FTB22149 17954158 G to A
FTB22150 22239878 G to C
FTB22151 11648633 G to A
FTB22152 15551443 A to C
FTB22153 11053217 T to C
FTB22154 15416664 G to A
FTB22155 3080340 A to G
FTB22156 3146712 A to G
FTB22157 3165902 G to A
FTB22158 3192133 G to C
FTB22159 3194459 A to C
FTB22160 3204749 A to T
FTB22161 3225727 G to A
FTB22162 3281277 T to A
FTB22163 3295723 G to A
FTB22164 3321600 T to A
FTB22165 3360677 C to G
FTB22166 3383335 A to G
FTB22167 3394028 T to C
FTB22168 3402977 C to T
FTB22169 3405665 C to T
FTB22170 3452015 A to G
FTB22171 3491128 T to C
FTB22172 3523871 G to A
FTB22173 3548631 A to C
FTB22174 3548686 G to C
FTB22175 3554341 A to G
FTB22176 3587408 G to T
FTB22177 3677038 T to C
FTB22178 3706286 A to G
FTB22179 3770769 T to A
FTB22180 3788498 A to G
FTB22181 3823321 A to G
FTB22182 3826230 C to G
FTB22183 3857823 T to C
FTB22184 3898308 G to A
FTB22185 3914056 A to G
FTB22186 3918828 G to T
FTB22187 3929498 T to C
FTB22188 3960569 A to C
FTB22189 3978045 T to C
FTB22190 4091674 G to T
FTB22191 4124513 G to A
FTB22192 4146499 T to C
FTB22193 4157663 T to C
FTB22194 4182056 A to G
FTB22195 4184228 C to T
FTB22196 4189718 T to C
FTB22197 4195329 G to A
FTB22198 4228399 G to T
FTB22199 4236057 T to C
FTB22200 4242316 T to C
FTB22201 4249469 A to G
FTB22202 4259304 G to T
FTB22203 4275318 T to C
FTB22204 4287635 T to C
FTB22205 4297287 G to A
FTB22206 4306247 A to C
FTB22207 4310296 T to G
FTB22208 4343406 G to T
FTB22209 4347625 A to G
FTB22210 4396798 A to C
FTB22211 4451756 A to G
FTB22212 4503020 G to A
FTB22213 4534076 C to T
FTB22214 4555295 G to A
FTB22215 4573094 G to A
FTB22216 4584410 T to C
FTB22217 4594363 C to A
FTB22218 4642721 G to T
FTB22219 4645588 G to T
FTB22220 4662562 T to C
FTB22221 4669710 C to A
FTB22222 4675605 G to A
FTB22223 4684221 C to A
FTB22224 4699846 G to C
FTB22225 4736864 A to G
FTB22226 4775204 G to C
FTB22227 4810693 T to C
FTB22228 4823023 G to T
FTB22229 4859856 G to C
FTB22230 4931368 C to T
FTB22231 4935517 T to A
FTB22232 5049915 T to C
FTB22233 5087436 G to C
FTB22234 5094040 A to G
FTB22235 5112038 A to C
FTB22236 5113154 A to G
FTB22237 5146295 C to A
FTB22238 5177831 A to G
FTB22239 5212337 G to T
FTB22240 5256763 C to T
FTB22241 5283755 C to G
FTB22242 5286676 G to C
FTB22243 5339742 T to C
FTB22244 5397812 G to A
FTB22245 5418384 G to T
FTB22246 5440531 A to G
FTB22247 5441507 T to C
FTB22248 5483259 T to C
FTB22249 5514609 A to G
FTB22250 5561308 A to G
FTB22251 5565666 A to G
FTB22252 5573854 C to A
FTB22253 5581331 T to G
FTB22254 5633540 A to T
FTB22255 5648659 G to A
FTB22256 5677451 T to C
FTB22257 5727199 C to T
FTB22258 5761386 G to A
FTB22259 5765291 A to G
FTB22260 5776467 T to A
FTB22261 5776477 T to G
FTB22262 5792391 T to C
FTB22263 5812656 T to C
FTB22264 5868162 G to A
FTB22265 5981166 G to A
FTB22266 6011281 A to G
FTB22267 6034105 T to C
FTB22268 6116586 T to A
FTB22269 6118202 A to C
FTB22270 6127210 C to T
FTB22271 6127754 C to G
FTB22272 6138023 C to T
FTB22273 6156089 T to C
FTB22274 6182052 C to T
FTB22275 6217635 C to T
FTB22276 6222379 T to C
FTB22277 6234389 G to A
FTB22278 6502322 T to C
FTB22279 6531156 G to C
FTB22280 6542618 T to C
FTB22281 6561984 A to G
FTB22282 6565597 G to C
FTB22283 6566080 A to C
FTB22284 6568657 G to A
FTB22285 6624308 G to A
FTB22286 6650829 T to C
FTB22287 6715245 A to C
FTB22288 6735907 C to T
FTB22289 9637671 A to G
FTB22290 9676414 T to G
FTB22291 9807602 C to T
FTB22292 9923963 G to C
FTB22293 9937381 G to T
FTB22294 10063322 C to A
FTB22295 11690884 A to T
FTB22296 11707061 G to A
FTB22297 11724783 T to A
FTB22298 11739983 G to T
FTB22299 11741151 A to T
FTB22300 12363330 C to G
FTB22301 15895962 A to G
FTB22302 16241613 C to A
FTB22303 16269760 C to T
FTB22304 21579595 C to T
FTB22305 21810966 A to C
FTB22306 21861547 C to T
FTB22307 8268456 C to T
FTB22308 4756430 G to A
FTB22309 8299791 C to G
FTB22310 11413714 T to G
FTB22311 22740323 A to C
FTB22312 7983354 C to CC
FTB22313 20051197 CT to C
FTB22314 12651813 GAG to G
FTB22315 17202577 TACT to T
FTB22316 10201146 C to A
FTB22317 10103560 G to A
FTB22318 20325436 A to G
FTB22319 12135371 G to C
FTB22320 5745543 A to T
FTB22321 14667623 A to G
FTB22322 8692053 T to G
FTB22323 8692056 A to C
FTB22324 16105727 T to C
FTB22325 19513026 C to T
FTB22326 15072508 A to C
FTB22327 7582244 G to T
FTB22328 8753594 C to A
FTB22329 20738120 C to T
FTB22330 13441995 C to T
FTB22331 22370027 G to A
FTB22332 6557717 AA to A
FTB22333 11280562 A to G
FTB22334 2799765 T to C
FTB22335 2800825 C to T
FTB22336 2847753 G to C
FTB22337 2849166 C to G
FTB22338 2868291 A to G
FTB22339 2869196 C to G
FTB22340 2871075 T to C
FTB22341 2894582 G to A
FTB22342 2895303 A to G
FTB22343 2909012 C to G
FTB22344 2915561 C to T
FTB22345 2920745 G to T
FTB22346 2926248 C to T
FTB22347 2936228 C to T
FTB22348 2943362 C to T
FTB22349 2954435 T to C
FTB22350 2966313 A to T
FTB22351 2968160 A to T
FTB22352 2968161 A to T
FTB22353 2969428 G to A
FTB22354 2995413 C to T
FTB22355 2997393 T to C
FTB22356 3018882 C to T
FTB22357 3022528 G to T
FTB22358 3023924 A to G
FTB22359 3041567 C to T
FTB22360 6790465 T to C
FTB22361 6809229 C to A
FTB22362 6809247 A to G
FTB22363 6869419 A to G
FTB22364 6876096 A to G
FTB22365 6884311 A to T
FTB22366 6887054 C to T
FTB22367 6896404 A to C
FTB22368 6925833 C to T
FTB22369 6938278 A to C
FTB22370 6958617 G to A
FTB22371 6960747 A to G
FTB22372 6966377 C to T
FTB22373 6970471 T to C
FTB22374 6981623 G to A
FTB22375 6983922 T to C
FTB22376 6984721 G to A
FTB22377 6992864 G to C
FTB22378 7000717 C to T
FTB22379 7007956 G to A
FTB22380 7011610 A to G
FTB22381 7023320 T to A
FTB22382 7024960 C to G
FTB22383 7054819 C to T
FTB22384 7076512 G to C
FTB22385 7081555 A to G
FTB22386 7084873 T to G
FTB22387 7096829 C to A
FTB22388 7097426 G to T
FTB22389 7115074 G to A
FTB22390 7132420 A to T
FTB22391 7145130 C to T
FTB22392 7149938 G to A
FTB22393 7162755 C to G
FTB22394 7169836 G to A
FTB22395 7182316 C to A
FTB22396 7212985 T to C
FTB22397 7217342 A to C
FTB22398 7265726 C to T
FTB22399 7281984 C to T
FTB22400 7291956 C to T
FTB22401 7311802 G to T
FTB22402 7311995 G to A
FTB22403 7329179 C to T
FTB22404 7332601 C to T
FTB22405 7333523 C to T
FTB22406 7342094 G to A
FTB22407 7352491 C to T
FTB22408 7358617 A to G
FTB22409 7377088 A to G
FTB22410 7378645 T to C
FTB22411 7386044 G to A
FTB22412 7414935 A to T
FTB22413 7418248 G to A
FTB22414 7421327 C to G
FTB22415 7433609 C to A
FTB22416 7436884 A to C
FTB22417 7437416 A to G
FTB22418 7451720 C to A
FTB22419 7452544 G to A
FTB22420 7464214 T to A
FTB22421 7464215 C to G
FTB22422 7472240 G to A
FTB22423 7479806 A to T
FTB22424 7483490 A to G
FTB22425 7487102 C to G
FTB22426 7488054 G to T
FTB22427 7496907 T to C
FTB22428 7498732 T to G
FTB22429 7502495 G to A
FTB22430 7507874 C to G
FTB22431 7519102 C to T
FTB22432 7520007 C to A
FTB22433 7532340 G to T
FTB22434 7544604 A to G
FTB22435 7547310 A to T
FTB22436 7567196 G to T
FTB22437 7591856 G to A
FTB22438 7592045 C to T
FTB22439 7596180 T to C
FTB22440 7599517 C to T
FTB22441 7602045 C to G
FTB22442 7602622 T to C
FTB22443 7651198 C to T
FTB22444 7677227 C to A
FTB22445 7701774 A to G
FTB22446 7702006 G to T
FTB22447 7726922 C to T
FTB22448 7731938 C to G
FTB22449 7733097 T to C
FTB22450 7746327 G to A
FTB22451 7749467 G to A
FTB22452 7758742 T to G
FTB22453 7774095 G to C
FTB22454 7781495 C to A
FTB22455 7804025 C to T
FTB22456 7804995 G to A
FTB22457 7808308 A to G
FTB22458 7838030 C to T
FTB22459 7845330 G to C
FTB22460 7860286 T to C
FTB22461 7866684 G to C
FTB22462 7877927 T to G
FTB22463 7899880 G to C
FTB22464 7906005 T to C
FTB22465 7914380 A to T
FTB22466 7916473 C to T
FTB22467 7920323 A to G
FTB22468 7921917 T to C
FTB22469 7923401 A to G
FTB22470 7936503 G to A
FTB22471 7945559 C to T
FTB22472 7946304 G to C
FTB22473 7949851 G to C
FTB22474 7956466 A to C
FTB22475 7958684 G to T
FTB22476 7966498 G to T
FTB22477 7974275 A to G
FTB22478 7980638 A to T
FTB22479 7983288 C to G
FTB22480 7985814 G to A
FTB22481 7998390 C to A
FTB22482 8002210 A to G
FTB22483 8019819 C to A
FTB22484 8020750 T to C
FTB22485 8020868 A to T
FTB22486 8023166 A to G
FTB22487 8040699 T to C
FTB22488 8054870 G to A
FTB22489 8057734 C to A
FTB22490 8069619 T to C
FTB22491 8079316 C to A
FTB22492 8087354 C to T
FTB22493 8091839 C to T
FTB22494 8102518 G to C
FTB22495 8110472 T to C
FTB22496 8133402 G to A
FTB22497 8148889 T to C
FTB22498 8159718 G to A
FTB22499 8163223 A to G
FTB22500 8181566 A to C
FTB22501 8184655 T to G
FTB22502 8187209 A to G
FTB22503 8190740 G to T
FTB22504 8192516 C to G
FTB22505 8196715 A to G
FTB22506 8219241 C to G
FTB22507 8229411 C to T
FTB22508 8234110 A to G
FTB22509 8245342 G to A
FTB22510 8245606 G to T
FTB22511 8256753 C to A
FTB22512 8260579 C to T
FTB22513 8279899 G to A
FTB22514 8291351 C to G
FTB22515 8293023 G to T
FTB22516 8302938 T to C
FTB22517 8325507 G to A
FTB22518 8346120 T to C
FTB22519 8354147 G to T
FTB22520 8378306 G to A
FTB22521 8394105 T to C
FTB22522 8413554 A to G
FTB22523 8428506 T to C
FTB22524 8433142 G to C
FTB22525 8445313 T to C
FTB22526 8448060 A to C
FTB22527 8462389 G to T
FTB22528 8477917 G to T
FTB22529 8493768 G to A
FTB22530 8499011 C to T
FTB22531 8532372 C to A
FTB22532 8535934 A to T
FTB22533 8539712 T to C
FTB22534 8549253 C to T
FTB22535 8550862 T to C
FTB22536 8581054 T to C
FTB22537 8593701 A to G
FTB22538 8597272 A to G
FTB22539 8610975 G to C
FTB22540 8614924 G to T
FTB22541 8628419 T to C
FTB22542 8631650 T to C
FTB22543 8638419 T to C
FTB22544 8643302 C to G
FTB22545 8650987 G to C
FTB22546 8657299 G to T
FTB22547 8657300 C to T
FTB22548 8657918 C to A
FTB22549 8664390 A to G
FTB22550 8665470 C to G
FTB22551 8665893 T to C
FTB22552 8666360 G to C
FTB22553 8678916 A to G
FTB22554 8682599 T to C
FTB22555 8695689 T to C
FTB22556 8699450 G to A
FTB22557 8715218 G to T
FTB22558 8717544 G to A
FTB22559 8721617 T to C
FTB22560 8722089 A to G
FTB22561 8725502 G to T
FTB22562 8727420 C to A
FTB22563 8741087 A to G
FTB22564 8748177 C to T
FTB22565 8755530 T to C
FTB22566 8781003 C to G
FTB22567 8792772 T to C
FTB22568 8799203 T to C
FTB22569 8801723 T to A
FTB22570 8804983 A to G
FTB22571 8811334 A to G
FTB22572 8811584 T to C
FTB22573 8830375 A to G
FTB22574 8830985 G to C
FTB22575 8847037 G to T
FTB22576 8862352 T to A
FTB22577 8863745 G to A
FTB22578 8863871 C to G
FTB22579 8868825 C to T
FTB22580 8889321 G to C
FTB22581 8899841 T to C
FTB22582 8900499 G to A
FTB22583 8911848 T to C
FTB22584 8941261 C to A
FTB22585 8942689 A to C
FTB22586 8955880 T to A
FTB22587 8974533 G to T
FTB22588 9011272 C to A
FTB22589 9033523 G to T
FTB22590 9040061 T to C
FTB22591 9041061 G to C
FTB22592 9043957 C to A
FTB22593 9109892 C to T
FTB22594 9110840 T to C
FTB22595 9116870 T to C
FTB22596 9131413 G to A
FTB22597 9150385 G to A
FTB22598 9187752 C to G
FTB22599 9196802 C to A
FTB22600 9205104 C to T
FTB22601 9214751 A to G
FTB22602 9233833 C to A
FTB22603 9234012 C to G
FTB22604 9239394 G to T
FTB22605 9265119 G to A
FTB22606 9279718 A to G
FTB22607 9291430 T to G
FTB22608 9330087 T to A
FTB22609 9555536 T to C
FTB22610 9558398 C to T
FTB22611 9565723 T to C
FTB22612 9585013 G to T
FTB22613 9602434 C to G
FTB22614 9615724 C to A
FTB22615 9621293 A to G
FTB22616 9991424 G to A
FTB22617 10004188 T to G
FTB22618 10004570 T to A
FTB22619 10014257 C to T
FTB22620 10019826 C to T
FTB22621 10023164 T to C
FTB22622 10047980 A to T
FTB22623 10048696 A to G
FTB22624 10050024 A to G
FTB22625 10050495 G to A
FTB22626 11770247 A to T
FTB22627 11772333 C to T
FTB22628 11774068 T to C
FTB22629 11779300 C to A
FTB22630 11782988 A to C
FTB22631 11786747 G to A
FTB22632 11794880 C to T
FTB22633 11808013 G to A
FTB22634 11809886 C to T
FTB22635 11817189 C to G
FTB22636 11817693 T to C
FTB22637 11852644 T to A
FTB22638 11856274 G to A
FTB22639 11864781 G to T
FTB22640 11884649 G to A
FTB22641 11901938 G to A
FTB22642 11916353 T to C
FTB22643 11925897 C to G
FTB22644 11926618 C to G
FTB22645 11941244 C to A
FTB22646 11945008 C to T
FTB22647 11945669 A to G
FTB22648 11969802 C to A
FTB22649 11971386 A to T
FTB22650 11975937 G to A
FTB22651 11979825 C to T
FTB22652 11984398 C to G
FTB22653 11986893 G to C
FTB22654 12013782 C to T
FTB22655 12026374 A to G
FTB22656 12028794 G to C
FTB22657 12030524 G to T
FTB22658 12031001 T to C
FTB22659 12037080 A to G
FTB22660 12047630 C to G
FTB22661 12048464 A to T
FTB22662 12051262 C to A
FTB22663 12052654 A to C
FTB22664 12052829 A to T
FTB22665 12059145 C to A
FTB22666 12063747 G to A
FTB22667 12075172 G to A
FTB22668 12085871 C to T
FTB22669 12087217 A to T
FTB22670 12095617 G to T
FTB22671 12097137 C to T
FTB22672 12120591 C to T
FTB22673 12122614 G to A
FTB22674 12126865 T to C
FTB22675 12132435 G to A
FTB22676 12134358 G to T
FTB22677 12134485 C to T
FTB22678 12144714 C to A
FTB22679 12146262 A to G
FTB22680 12150492 C to A
FTB22681 12159624 T to C
FTB22682 12161815 C to T
FTB22683 12163104 G to A
FTB22684 12168477 G to C
FTB22685 12172092 C to A
FTB22686 12174962 C to A
FTB22687 12189388 A to C
FTB22688 12190030 A to G
FTB22689 12195394 A to C
FTB22690 12196543 A to G
FTB22691 12204362 A to G
FTB22692 12206292 G to A
FTB22693 12206812 C to G
FTB22694 12231986 G to A
FTB22695 12234178 T to C
FTB22696 12236853 C to T
FTB22697 12246417 A to C
FTB22698 12248328 T to C
FTB22699 12250823 C to T
FTB22700 12251783 C to A
FTB22701 12256211 T to C
FTB22702 12266886 A to G
FTB22703 12267921 G to A
FTB22704 12272195 T to C
FTB22705 12278012 C to G
FTB22706 12288851 G to A
FTB22707 12294374 A to G
FTB22708 12324267 G to A
FTB22709 12325278 C to G
FTB22710 12325667 A to G
FTB22711 12334669 A to G
FTB22712 12348424 A to G
FTB22713 12350399 C to G
FTB22714 12390640 G to C
FTB22715 12396283 C to G
FTB22716 12400107 A to G
FTB22717 12406821 T to C
FTB22718 12412833 G to C
FTB22719 12425040 G to A
FTB22720 12430268 T to C
FTB22721 12432980 C to G
FTB22722 12460194 C to A
FTB22723 12524950 G to A
FTB22724 12527450 T to G
FTB22725 12536771 T to A
FTB22726 12537056 C to T
FTB22727 12539921 C to T
FTB22728 12539995 A to G
FTB22729 12545542 G to C
FTB22730 12553153 G to T
FTB22731 12558113 G to T
FTB22732 12559144 G to A
FTB22733 12565687 T to C
FTB22734 12577304 C to G
FTB22735 12581706 G to A
FTB22736 12595262 G to A
FTB22737 12611981 C to A
FTB22738 12621770 A to C
FTB22739 12622918 C to A
FTB22740 12631084 G to A
FTB22741 12632395 A to G
FTB22742 12636374 C to G
FTB22743 12639167 A to G
FTB22744 12642769 C to T
FTB22745 12673756 A to G
FTB22746 12686667 G to C
FTB22747 12700610 T to C
FTB22748 12708275 C to T
FTB22749 12711478 G to T
FTB22750 12727074 A to G
FTB22751 12727875 C to T
FTB22752 12730016 G to A
FTB22753 12735547 C to T
FTB22754 12738692 C to A
FTB22755 12746156 T to C
FTB22756 12747017 G to A
FTB22757 12752222 T to C
FTB22758 12758966 C to T
FTB22759 12762077 C to T
FTB22760 12768049 A to G
FTB22761 12773286 G to A
FTB22762 12773376 G to T
FTB22763 12781459 C to T
FTB22764 12793639 C to A
FTB22765 12796701 A to T
FTB22766 12806985 G to C
FTB22767 12839684 G to A
FTB22768 12858861 G to A
FTB22769 12861908 A to C
FTB22770 12871237 T to C
FTB22771 12871393 A to T
FTB22772 12877092 C to T
FTB22773 12893744 A to G
FTB22774 12894281 T to C
FTB22775 12902364 T to C
FTB22776 12910079 C to A
FTB22777 12915612 T to C
FTB22778 12919484 A to G
FTB22779 12924256 G to A
FTB22780 12928378 C to T
FTB22781 12933575 T to C
FTB22782 12961005 G to C
FTB22783 12984520 G to A
FTB22784 12994914 G to A
FTB22785 13012605 G to T
FTB22786 13013240 C to G
FTB22787 13038914 A to G
FTB22788 13044618 T to C
FTB22789 13047683 G to T
FTB22790 13054998 G to A
FTB22791 13082223 T to C
FTB22792 13096745 C to T
FTB22793 13107819 T to G
FTB22794 13129594 A to G
FTB22795 13141651 G to A
FTB22796 13141992 C to T
FTB22797 13146822 G to A
FTB22798 13149767 T to C
FTB22799 13164150 T to C
FTB22800 13190793 T to G
FTB22801 13193223 A to C
FTB22802 13198867 C to G
FTB22803 13202489 A to G
FTB22804 13228857 T to C
FTB22805 13239870 A to G
FTB22806 13244034 C to T
FTB22807 13253532 T to C
FTB22808 13255145 G to A
FTB22809 13260408 T to C
FTB22810 13263336 G to A
FTB22811 13268416 G to A
FTB22812 13274578 G to A
FTB22813 13279537 C to T
FTB22814 13286104 T to C
FTB22815 13298558 T to A
FTB22816 13298559 C to T
FTB22817 13305803 G to C
FTB22818 13309571 A to T
FTB22819 13309820 A to G
FTB22820 13311177 C to T
FTB22821 13323039 G to A
FTB22822 13329190 G to A
FTB22823 13331495 A to G
FTB22824 13335547 A to G
FTB22825 13360953 C to G
FTB22826 13363156 C to G
FTB22827 13386662 A to G
FTB22828 13388662 T to C
FTB22829 13398437 C to T
FTB22830 13398517 T to G
FTB22831 13418002 T to C
FTB22832 13418692 A to G
FTB22833 13438793 G to A
FTB22834 13451485 G to A
FTB22835 13460131 A to G
FTB22836 13463336 G to A
FTB22837 13467640 G to A
FTB22838 13474873 A to G
FTB22839 13475429 T to A
FTB22840 13476996 A to T
FTB22841 13484656 C to G
FTB22842 13485347 A to G
FTB22843 13488368 T to C
FTB22844 13509130 A to G
FTB22845 13509840 C to T
FTB22846 13510951 C to G
FTB22847 13513757 A to G
FTB22848 13565440 C to T
FTB22849 13565459 C to A
FTB22850 13582571 A to G
FTB22851 13590503 C to A
FTB22852 13606058 C to A
FTB22853 13606418 C to T
FTB22854 13607133 C to T
FTB22855 13612976 C to T
FTB22856 13616205 C to G
FTB22857 13618647 A to G
FTB22858 13621697 C to T
FTB22859 13624022 G to A
FTB22860 13638861 T to G
FTB22861 13639599 G to A
FTB22862 13656141 C to G
FTB22863 13657153 G to T
FTB22864 13657259 G to T
FTB22865 13663900 G to A
FTB22866 13680920 T to C
FTB22867 13681694 G to A
FTB22868 13688319 A to T
FTB22869 13689116 T to C
FTB22870 13707098 G to T
FTB22871 13750974 G to A
FTB22872 13752236 G to T
FTB22873 13753247 C to T
FTB22874 13764112 C to A
FTB22875 13782889 C to T
FTB22876 13784400 T to C
FTB22877 13784851 G to A
FTB22878 13785319 C to T
FTB22879 13802806 A to G
FTB22880 13804123 C to T
FTB22881 13808177 T to A
FTB22882 13865445 T to C
FTB22883 13870742 C to T
FTB22884 13871009 T to A
FTB22885 13879966 C to A
FTB22886 13879967 T to A
FTB22887 13898784 G to A
FTB22888 13902380 C to G
FTB22889 13903601 A to G
FTB22890 13906015 A to T
FTB22891 13923212 A to G
FTB22892 13928530 C to A
FTB22893 13932862 A to G
FTB22894 13939376 A to G
FTB22895 13946527 G to T
FTB22896 13962313 T to C
FTB22897 13963109 A to C
FTB22898 13965828 T to C
FTB22899 13967450 G to C
FTB22900 13972807 A to G
FTB22901 13973687 G to A
FTB22902 13977196 T to G
FTB22903 14020106 A to G
FTB22904 14062693 A to T
FTB22905 14105026 C to T
FTB22906 14118381 G to A
FTB22907 14125109 A to G
FTB22908 14142054 C to T
FTB22909 14146354 C to T
FTB22910 14155402 A to T
FTB22911 14157147 G to A
FTB22912 14160336 T to G
FTB22913 14164540 G to A
FTB22914 14166467 A to T
FTB22915 14170280 G to T
FTB22916 14178815 G to T
FTB22917 14188393 A to C
FTB22918 14205360 G to T
FTB22919 14209216 A to G
FTB22920 14214577 C to G
FTB22921 14227542 T to C
FTB22922 14236423 A to T
FTB22923 14246826 G to T
FTB22924 14248584 C to A
FTB22925 14256430 G to C
FTB22926 14259007 C to T
FTB22927 14264892 G to A
FTB22928 14265375 G to A
FTB22929 14270390 A to T
FTB22930 14270432 G to A
FTB22931 14280576 G to T
FTB22932 14303448 T to C
FTB22933 14313183 C to A
FTB22934 14320311 G to C
FTB22935 14326658 T to C
FTB22936 14330866 T to G
FTB22937 14336489 A to G
FTB22938 14341768 C to T
FTB22939 14342938 T to C
FTB22940 14346113 G to T
FTB22941 14359970 G to A
FTB22942 14361100 C to T
FTB22943 14373455 A to C
FTB22944 14394617 G to A
FTB22945 14398914 A to T
FTB22946 14433533 C to T
FTB22947 14434469 T to G
FTB22948 14438619 T to G
FTB22949 14449207 C to A
FTB22950 14456281 T to C
FTB22951 14461599 G to C
FTB22952 14462432 G to A
FTB22953 14475675 G to T
FTB22954 14481485 T to G
FTB22955 14491405 A to C
FTB22956 14510650 G to T
FTB22957 14512611 G to T
FTB22958 14519277 C to T
FTB22959 14530375 T to C
FTB22960 14550807 C to G
FTB22961 14554926 T to C
FTB22962 14562774 T to G
FTB22963 14577200 C to A
FTB22964 14596124 C to G
FTB22965 14596282 G to C
FTB22966 14601704 C to G
FTB22967 14613289 T to A
FTB22968 14613461 T to A
FTB22969 14626663 A to G
FTB22970 14632234 C to T
FTB22971 14634651 G to T
FTB22972 14648728 G to A
FTB22973 14658916 C to A
FTB22974 14661866 A to T
FTB22975 14671568 T to C
FTB22976 14693835 A to G
FTB22977 14701622 C to T
FTB22978 14715553 A to G
FTB22979 14725460 A to C
FTB22980 14728233 T to C
FTB22981 14733913 A to G
FTB22982 14736844 A to G
FTB22983 14759746 A to G
FTB22984 14770557 C to T
FTB22985 14776598 A to G
FTB22986 14778902 C to A
FTB22987 14784374 C to T
FTB22988 14785168 C to T
FTB22989 14786397 T to A
FTB22990 14792657 G to A
FTB22991 14796148 A to G
FTB22992 14807643 A to G
FTB22993 14816617 T to A
FTB22994 14822852 C to T
FTB22995 14826831 T to C
FTB22996 14829621 C to A
FTB22997 14834574 A to G
FTB22998 14842173 A to G
FTB22999 14842176 C to T
FTB23000 14877442 T to C
FTB23001 14879067 T to G
FTB23002 14889199 T to C
FTB23003 14898970 G to A
FTB23004 14903905 A to G
FTB23005 14905483 G to C
FTB23006 14910068 G to A
FTB23007 14919473 A to G
FTB23008 14927027 C to A
FTB23009 14960499 C to G
FTB23010 14967545 A to C
FTB23011 14975451 C to T
FTB23012 14980730 G to C
FTB23013 14980873 A to C
FTB23014 14988078 G to A
FTB23015 14990449 C to A
FTB23016 15000221 A to G
FTB23017 15002283 T to C
FTB23018 15005387 T to G
FTB23019 15030667 G to A
FTB23020 15032357 G to T
FTB23021 15110730 T to G
FTB23022 15131420 T to C
FTB23023 15132191 T to C
FTB23024 15132195 G to T
FTB23025 15138796 C to A
FTB23026 15139215 C to A
FTB23027 15140467 A to G
FTB23028 15143834 G to A
FTB23029 15166262 T to A
FTB23030 15199829 C to A
FTB23031 15200184 C to T
FTB23032 15202739 C to T
FTB23033 15222051 T to A
FTB23034 15230769 G to A
FTB23035 15250906 C to G
FTB23036 15264325 C to T
FTB23037 15271468 A to G
FTB23038 15273524 C to G
FTB23039 15274190 G to C
FTB23040 15278707 A to G
FTB23041 15278757 T to C
FTB23042 15289507 T to C
FTB23043 15289754 C to T
FTB23044 15307100 C to T
FTB23045 15309342 A to C
FTB23046 15311426 T to C
FTB23047 15319086 G to A
FTB23048 15324127 G to C
FTB23049 15324436 A to G
FTB23050 15328997 T to C
FTB23051 15339707 A to C
FTB23052 15343841 C to T
FTB23053 15370364 G to A
FTB23054 15370780 A to G
FTB23055 15374069 C to A
FTB23056 15374429 C to A
FTB23057 15383801 G to A
FTB23058 15386969 T to C
FTB23059 15390525 T to A
FTB23060 15391758 G to A
FTB23061 15395734 T to A
FTB23062 15400417 C to T
FTB23063 15405694 G to T
FTB23064 15417283 C to T
FTB23065 15423990 C to T
FTB23066 15432005 C to A
FTB23067 15437646 A to T
FTB23068 15461273 C to G
FTB23069 15463446 C to G
FTB23070 15464188 C to T
FTB23071 15464847 T to A
FTB23072 15475982 G to T
FTB23073 15476686 G to T
FTB23074 15478844 G to A
FTB23075 15480333 G to T
FTB23076 15503376 T to C
FTB23077 15505444 A to T
FTB23078 15506203 C to G
FTB23079 15512102 C to T
FTB23080 15527735 T to G
FTB23081 15532898 C to T
FTB23082 15535660 G to A
FTB23083 15544232 A to G
FTB23084 15547095 G to C
FTB23085 15548419 A to G
FTB23086 15556362 T to C
FTB23087 15573983 C to T
FTB23088 15574025 T to C
FTB23089 15594972 G to C
FTB23090 15597171 A to G
FTB23091 15600611 T to C
FTB23092 15607646 C to T
FTB23093 15609187 C to T
FTB23094 15622335 A to G
FTB23095 15661681 G to A
FTB23096 15662436 C to A
FTB23097 15663255 A to G
FTB23098 15674035 C to T
FTB23099 15674333 T to C
FTB23100 15676177 A to T
FTB23101 15684586 C to G
FTB23102 15692699 G to T
FTB23103 15706538 T to C
FTB23104 15731534 G to A
FTB23105 15739425 T to C
FTB23106 15743868 C to T
FTB23107 15745617 G to T
FTB23108 15749542 A to G
FTB23109 15757780 A to G
FTB23110 15767041 T to C
FTB23111 15770801 G to T
FTB23112 15775014 G to T
FTB23113 15776180 T to A
FTB23114 15778733 T to C
FTB23115 15786328 C to T
FTB23116 15795780 C to A
FTB23117 15796890 T to C
FTB23118 15800066 G to A
FTB23119 15808646 A to C
FTB23120 15809102 A to C
FTB23121 15809708 T to A
FTB23122 15812466 C to A
FTB23123 15835677 G to A
FTB23124 15841183 C to T
FTB23125 15853316 C to G
FTB23126 15859389 T to C
FTB23127 15859417 C to G
FTB23128 15918517 C to T
FTB23129 15919120 G to A
FTB23130 15920341 T to G
FTB23131 15920848 C to T
FTB23132 15923295 G to A
FTB23133 15924051 T to C
FTB23134 15924053 A to G
FTB23135 15927190 C to T
FTB23136 15936202 G to T
FTB23137 15941924 C to A
FTB23138 15948103 C to T
FTB23139 15950333 A to G
FTB23140 15967296 T to A
FTB23141 15977424 T to G
FTB23142 15987485 C to T
FTB23143 15992191 C to A
FTB23144 15992874 A to G
FTB23145 15997313 T to A
FTB23146 16006901 A to T
FTB23147 16013619 C to T
FTB23148 16015780 G to A
FTB23149 16016082 C to A
FTB23150 16023319 T to C
FTB23151 16035700 C to T
FTB23152 16038218 T to G
FTB23153 16041244 A to G
FTB23154 16062724 A to G
FTB23155 16066621 C to T
FTB23156 16092918 T to C
FTB23157 16092973 T to A
FTB23158 16097651 T to G
FTB23159 16109900 G to C
FTB23160 16110359 C to A
FTB23161 16113152 G to A
FTB23162 16132340 G to A
FTB23163 16149529 G to A
FTB23164 16278871 A to T
FTB23165 16283436 C to T
FTB23166 16292819 A to G
FTB23167 16298713 G to T
FTB23168 16301267 A to T
FTB23169 16301365 T to G
FTB23170 16304164 G to A
FTB23171 16309872 A to G
FTB23172 16426391 G to C
FTB23173 16439623 G to A
FTB23174 16452766 G to C
FTB23175 16474830 G to A
FTB23176 16479382 T to A
FTB23177 16488814 A to G
FTB23178 16497348 G to A
FTB23179 16500103 T to A
FTB23180 16504695 A to G
FTB23181 16514092 G to T
FTB23182 16515549 C to T
FTB23183 16516191 G to A
FTB23184 16527644 A to C
FTB23185 16535700 C to A
FTB23186 16590734 G to C
FTB23187 16597637 A to T
FTB23188 16601103 A to C
FTB23189 16607991 T to C
FTB23190 16608153 C to A
FTB23191 16612196 G to T
FTB23192 16617342 C to T
FTB23193 16624900 C to A
FTB23194 16625661 T to C
FTB23195 16658311 T to C
FTB23196 16658618 T to C
FTB23197 16675847 C to T
FTB23198 16676284 G to T
FTB23199 16677871 C to T
FTB23200 16687594 G to A
FTB23201 16693880 A to G
FTB23202 16696152 G to A
FTB23203 16696521 A to T
FTB23204 16697825 C to G
FTB23205 16727011 C to T
FTB23206 16730080 T to C
FTB23207 16734638 G to A
FTB23208 16743782 A to T
FTB23209 16769591 T to C
FTB23210 16774966 C to T
FTB23211 16807253 A to T
FTB23212 16817563 T to C
FTB23213 16821572 C to A
FTB23214 16822954 G to C
FTB23215 16835174 G to A
FTB23216 16839256 A to G
FTB23217 16842525 A to G
FTB23218 16851994 T to C
FTB23219 16864829 G to A
FTB23220 16865061 G to C
FTB23221 16883762 C to T
FTB23222 16884407 G to A
FTB23223 16893609 C to A
FTB23224 16895777 C to G
FTB23225 16896998 C to G
FTB23226 16899683 A to G
FTB23227 16908357 T to A
FTB23228 16911008 T to A
FTB23229 16926119 A to G
FTB23230 16927568 A to T
FTB23231 16933362 A to G
FTB23232 16934830 T to C
FTB23233 16951995 T to C
FTB23234 16952325 C to G
FTB23235 16952732 G to A
FTB23236 16953103 G to A
FTB23237 16954319 C to A
FTB23238 16954385 G to T
FTB23239 16955486 T to C
FTB23240 16961691 A to T
FTB23241 16963124 A to C
FTB23242 16968724 G to T
FTB23243 16980264 G to C
FTB23244 16981591 A to T
FTB23245 16991726 G to A
FTB23246 16993817 G to A
FTB23247 17002972 C to T
FTB23248 17019216 T to A
FTB23249 17022882 C to A
FTB23250 17023906 G to A
FTB23251 17046014 A to G
FTB23252 17046887 G to A
FTB23253 17059075 C to T
FTB23254 17070930 A to G
FTB23255 17070941 G to A
FTB23256 17070944 C to T
FTB23257 17071384 G to A
FTB23258 17073984 G to A
FTB23259 17085206 C to A
FTB23260 17101015 C to T
FTB23261 17102312 G to A
FTB23262 17106341 A to G
FTB23263 17110318 T to G
FTB23264 17120231 T to C
FTB23265 17123179 T to C
FTB23266 17123353 A to G
FTB23267 17139267 G to T
FTB23268 17141433 T to A
FTB23269 17142254 G to C
FTB23270 17151189 C to A
FTB23271 17152182 T to C
FTB23272 17155705 T to A
FTB23273 17157647 G to T
FTB23274 17159639 A to G
FTB23275 17161982 C to A
FTB23276 17167379 T to G
FTB23277 17173151 G to T
FTB23278 17220635 T to C
FTB23279 17223470 T to C
FTB23280 17226203 G to A
FTB23281 17227040 T to C
FTB23282 17244609 T to A
FTB23283 17262075 T to C
FTB23284 17267065 A to T
FTB23285 17269527 G to T
FTB23286 17279314 C to G
FTB23287 17280917 G to T
FTB23288 17291174 A to C
FTB23289 17296325 G to T
FTB23290 17304975 C to T
FTB23291 17307273 A to T
FTB23292 17318004 G to A
FTB23293 17336866 A to T
FTB23294 17349789 C to G
FTB23295 17354363 G to A
FTB23296 17355874 G to A
FTB23297 17360224 T to A
FTB23298 17364013 G to C
FTB23299 17366829 C to T
FTB23300 17368689 C to A
FTB23301 17373816 A to G
FTB23302 17386227 G to A
FTB23303 17392029 A to G
FTB23304 17398521 C to T
FTB23305 17399005 T to A
FTB23306 17399006 T to G
FTB23307 17401000 A to T
FTB23308 17418985 G to A
FTB23309 17427786 G to A
FTB23310 17440436 A to G
FTB23311 18647184 T to C
FTB23312 18652257 T to C
FTB23313 18662274 A to G
FTB23314 18871636 T to C
FTB23315 18874558 C to G
FTB23316 18882661 G to A
FTB23317 18883098 T to C
FTB23318 18905869 A to T
FTB23319 18915814 C to A
FTB23320 18928529 G to A
FTB23321 18931334 A to T
FTB23322 18936282 C to T
FTB23323 18941392 G to C
FTB23324 18951927 T to C
FTB23325 18960646 C to A
FTB23326 18963245 T to A
FTB23327 18987338 C to T
FTB23328 18999158 T to C
FTB23329 19004599 C to A
FTB23330 19014863 G to A
FTB23331 19015080 C to A
FTB23332 19026620 A to C
FTB23333 19050320 C to T
FTB23334 19050524 C to G
FTB23335 19051129 T to C
FTB23336 19051154 G to T
FTB23337 19066844 T to C
FTB23338 19099453 T to C
FTB23339 19100814 G to T
FTB23340 19127389 C to T
FTB23341 19140569 G to A
FTB23342 19146897 C to G
FTB23343 19151249 A to G
FTB23344 19151363 C to A
FTB23345 19167672 C to T
FTB23346 19167931 G to A
FTB23347 19173930 T to C
FTB23348 19178123 C to T
FTB23349 19180604 C to A
FTB23350 19186703 A to G
FTB23351 19189638 G to T
FTB23352 19234657 G to T
FTB23353 19246740 T to G
FTB23354 19265692 T to A
FTB23355 19295371 T to G
FTB23356 19297692 C to A
FTB23357 19305023 T to C
FTB23358 19334370 G to A
FTB23359 19340489 T to C
FTB23360 19341003 T to G
FTB23361 19351463 A to C
FTB23362 19354952 A to G
FTB23363 19357219 C to T
FTB23364 19360429 G to A
FTB23365 19385836 C to G
FTB23366 19392300 A to G
FTB23367 19395402 C to T
FTB23368 19402880 C to T
FTB23369 19403049 T to A
FTB23370 19424448 T to A
FTB23371 19429586 C to A
FTB23372 19484957 C to T
FTB23373 19501404 A to G
FTB23374 19504326 C to T
FTB23375 19510210 C to A
FTB23376 19511266 T to C
FTB23377 19523517 G to T
FTB23378 19538479 C to T
FTB23379 19542753 A to G
FTB23380 19545315 A to G
FTB23381 19550290 G to A
FTB23382 19552299 C to A
FTB23383 19568717 A to C
FTB23384 19579698 A to G
FTB23385 19591056 C to T
FTB23386 19600700 A to C
FTB23387 19600701 A to T
FTB23388 19602218 G to A
FTB23389 19626564 T to C
FTB23390 19627439 G to C
FTB23391 19639192 T to A
FTB23392 19649423 T to A
FTB23393 19649980 G to A
FTB23394 19653895 G to A
FTB23395 19655136 G to A
FTB23396 19656876 T to G
FTB23397 19657751 T to C
FTB23398 19663593 C to T
FTB23399 19668198 G to A
FTB23400 19680364 G to A
FTB23401 19712311 T to C
FTB23402 19720539 C to T
FTB23403 19726421 G to C
FTB23404 19732269 A to C
FTB23405 19733513 A to G
FTB23406 19743735 A to G
FTB23407 19758342 G to A
FTB23408 19784470 A to G
FTB23409 19800609 A to T
FTB23410 19807814 C to G
FTB23411 19813391 C to T
FTB23412 19814091 C to T
FTB23413 19815087 G to A
FTB23414 19816980 G to A
FTB23415 19820551 A to G
FTB23416 19830178 A to C
FTB23417 19830311 G to A
FTB23418 19843506 G to A
FTB23419 19856811 A to G
FTB23420 19859031 G to A
FTB23421 19859152 C to A
FTB23422 19872806 G to C
FTB23423 19878586 G to C
FTB23424 19880517 G to T
FTB23425 19882625 G to T
FTB23426 19886763 G to A
FTB23427 19887132 C to A
FTB23428 19896982 A to G
FTB23429 19902362 A to C
FTB23430 19939735 T to C
FTB23431 19941888 T to G
FTB23432 19968065 A to G
FTB23433 19978455 T to C
FTB23434 19995756 C to T
FTB23435 20013216 G to A
FTB23436 20017518 C to A
FTB23437 20022955 A to G
FTB23438 20028404 A to G
FTB23439 20030006 C to T
FTB23440 20040297 C to A
FTB23441 20363315 T to C
FTB23442 20391300 G to A
FTB23443 20392530 T to C
FTB23444 20398166 G to A
FTB23445 20412686 G to T
FTB23446 20417095 A to C
FTB23447 20427518 C to T
FTB23448 20457461 G to A
FTB23449 20465905 C to A
FTB23450 20477030 C to A
FTB23451 20502614 G to A
FTB23452 20503516 A to G
FTB23453 20544778 C to A
FTB23454 20554747 C to G
FTB23455 20571337 A to G
FTB23456 20582499 C to A
FTB23457 20593098 C to T
FTB23458 20605615 T to A
FTB23459 20611068 A to G
FTB23460 20612011 G to A
FTB23461 20616469 A to G
FTB23462 20620239 C to A
FTB23463 20635347 A to G
FTB23464 20640946 A to T
FTB23465 20650387 T to C
FTB23466 20656288 G to A
FTB23467 20670702 C to T
FTB23468 20673489 T to A
FTB23469 20678414 G to A
FTB23470 20683906 T to A
FTB23471 20692957 T to C
FTB23472 20714735 C to A
FTB23473 20716444 T to C
FTB23474 20717839 G to A
FTB23475 20726104 C to G
FTB23476 20732705 G to C
FTB23477 20735971 C to T
FTB23478 20741988 A to C
FTB23479 20747852 A to G
FTB23480 20755767 C to T
FTB23481 20776901 T to C
FTB23482 20811469 A to G
FTB23483 20816798 C to G
FTB23484 20859984 G to A
FTB23485 20881580 G to T
FTB23486 20887725 G to A
FTB23487 20909535 C to T
FTB23488 20937942 C to A
FTB23489 20962775 C to T
FTB23490 20963790 G to C
FTB23491 20969569 G to T
FTB23492 21038743 A to G
FTB23493 21045551 C to A
FTB23494 21045785 T to G
FTB23495 21063563 T to C
FTB23496 21071282 A to G
FTB23497 21076190 A to T
FTB23498 21077102 C to T
FTB23499 21081100 C to A
FTB23500 21081448 T to G
FTB23501 21082519 A to C
FTB23502 21089753 A to G
FTB23503 21090091 A to C
FTB23504 21093603 C to A
FTB23505 21099731 C to T
FTB23506 21126116 T to A
FTB23507 21153408 A to G
FTB23508 21154922 A to G
FTB23509 21174468 T to C
FTB23510 21194024 G to A
FTB23511 21195254 T to C
FTB23512 21223390 T to C
FTB23513 21231109 T to C
FTB23514 21231835 G to A
FTB23515 21259562 G to C
FTB23516 21262644 A to G
FTB23517 21272675 T to G
FTB23518 21273303 T to G
FTB23519 21310415 C to T
FTB23520 21310419 T to C
FTB23521 21320315 C to T
FTB23522 21321597 A to T
FTB23523 21365757 G to A
FTB23524 21370913 C to T
FTB23525 21382426 C to G
FTB23526 21393888 G to T
FTB23527 21401052 T to C
FTB23528 21426378 T to C
FTB23529 21442620 G to T
FTB23530 21443166 C to T
FTB23531 21454387 G to A
FTB23532 21455285 G to A
FTB23533 21455894 C to T
FTB23534 21465919 T to G
FTB23535 21470196 C to A
FTB23536 21585537 G to T
FTB23537 21587118 G to T
FTB23538 21589484 T to C
FTB23539 21597208 C to G
FTB23540 21599537 T to C
FTB23541 21603003 T to C
FTB23542 21615676 A to G
FTB23543 21658665 G to T
FTB23544 21671431 C to G
FTB23545 21707138 C to G
FTB23546 21709918 A to T
FTB23547 21711208 C to T
FTB23548 21714430 A to T
FTB23549 21821514 G to C
FTB23550 21823395 G to A
FTB23551 21831119 A to G
FTB23552 21839980 C to A
FTB23553 21845026 G to A
FTB23554 22230667 A to C
FTB23555 22232378 T to C
FTB23556 22238990 A to G
FTB23557 22242360 A to G
FTB23558 22246842 C to T
FTB23559 22250156 A to G
FTB23560 22264106 C to T
FTB23561 22274318 G to C
FTB23562 22275234 G to A
FTB23563 22283721 T to C
FTB23564 22291190 G to C
FTB23565 22298456 A to G
FTB23566 22301626 T to G
FTB23567 22326566 C to A
FTB23568 22333038 G to A
FTB23569 26317780 G to A
FTB23570 26322160 G to T
FTB23571 26327785 A to G
FTB23572 26345952 G to T
FTB23573 26351326 T to C
FTB23574 26359801 T to A
FTB23575 26366108 C to T
FTB23576 26370296 A to G
FTB23577 26370547 T to A
FTB23578 26378939 C to G
FTB23579 26382955 G to A
FTB23580 26400148 C to G
FTB23581 26410431 G to C
FTB23582 26411969 A to C
FTB23583 26413120 A to G
FTB23584 26448006 T to A
FTB23585 26473735 A to C
FTB23586 26491407 A to T
FTB23587 26519098 T to G
FTB23588 26521592 A to T
FTB23589 26538368 C to T
FTB23590 26553583 C to T
FTB23591 26578552 A to T
FTB23592 26579316 T to A
FTB23593 26582053 G to T
FTB23594 26595477 G to T
FTB23595 26597311 A to G
FTB23596 26607823 C to T
FTB23597 26612212 G to A
FTB23598 3094740 A to G
FTB23599 3144883 C to A
FTB23600 3141761 A to G
FTB23601 3278692 A to C
FTB23602 3308713 A to G
FTB23603 3395457 G to A
FTB23604 3434953 T to C
FTB23605 3541553 A to C
FTB23606 3596067 A to T
FTB23607 3653454 G to A
FTB23608 3693532 A to C
FTB23609 3759248 G to T
FTB23610 3983236 A to T
FTB23611 4175914 G to A
FTB23612 4462545 T to C
FTB23613 4485146 T to C
FTB23614 4809018 G to A
FTB23615 4819172 C to T
FTB23616 4823749 A to G
FTB23617 4973357 G to A
FTB23618 4986442 T to A
FTB23619 5073511 A to T
FTB23620 5350170 G to A
FTB23621 5389319 A to G
FTB23622 5433973 A to G
FTB23623 5574596 A to G
FTB23624 5773377 A to G
FTB23625 5811265 G to T
FTB23626 5931948 C to T
FTB23627 5947411 C to A
FTB23628 6058055 A to G
FTB23629 6130981 A to T
FTB23630 6137777 G to A
FTB23631 6200091 A to G
FTB23632 6479071 C to G
FTB23633 7367208 C to A
FTB23634 9548291 C to T
FTB23635 9551047 G to A
FTB23636 9909072 G to T
FTB23637 9919185 G to A
FTB23638 9950716 G to A
FTB23639 14116159 C to A
FTB23640 21484745 G to A
FTB23641 21754501 C to T
FTB23642 20526275 T to C
FTB23643 21690991 C to A
FTB23644 15216775 T to C
FTB23645 14650881 T to C
FTB23646 16537307 T to C
FTB23647 19572832 C to A
FTB23648 19706206 G to A
FTB23649 19277456 C to A
FTB23650 20860354 A to G
FTB23651 14896193 G to C
FTB23652 19704502 C to T
FTB23653 15191538 A to G
FTB23654 18671059 C to T
FTB23655 8728415 G to A
FTB23656 19298354 C to T
FTB23657 15768248 A to G
FTB23658 19129333 A to G
FTB23659 16293212 C to T
FTB23660 13729525 A to G
FTB23661 6978172 C to G
FTB23662 15246989 G to A
FTB23663 15404201 C to A
FTB23664 15766428 G to A
FTB23665 11972141 C to A
FTB23666 20569813 T to C
FTB23667 21845160 A to G
FTB23668 19679931 C to T
FTB23669 17454160 A to T
FTB23670 12016263 G to A
FTB23671 8928644 G to A
FTB23672 21103955 T to G
FTB23673 10013966 C to T
FTB23674 18927543 T to C
FTB23675 20517311 A to G
FTB23676 8712854 C to T
FTB23677 21241981 C to T
FTB23678 20805081 G to C
FTB23679 9305395 A to G
FTB23680 7827342 G to C
FTB23681 20577294 A to G
FTB23682 19703460 G to A
FTB23683 17193461 A to T
FTB23684 13793156 A to T
FTB23685 8296028 T to C
FTB23686 8680309 C to T
FTB23687 13639818 A to G
FTB23688 12418165 T to C
FTB23689 19590493 A to G
FTB23690 15597009 A to G
FTB23691 9981573 T to C
FTB23692 20030549 T to C
FTB23693 8364558 A to T
FTB23694 8725918 C to T
FTB23695 16892281 T to C
FTB23696 22309211 T to C
FTB23697 13983250 T to A
FTB23698 14965981 G to A
FTB23699 8750221 A to G
FTB23700 20556373 G to A
FTB23701 8870241 G to C
FTB23702 10006099 T to C
FTB23703 15937548 A to G
FTB23704 12955474 T to C
FTB23705 11944077 G to C
FTB23706 16795201 G to C
FTB23707 11870896 G to A
FTB23708 15925773 A to T
FTB23709 8771840 A to G
FTB23710 16983757 A to G
FTB23711 16979242 T to C
FTB23712 12017529 C to T
FTB23713 21637378 T to C
FTB23714 18668997 C to T
FTB23715 20547913 T to C
FTB23716 8780564 T to C
FTB23717 15634796 C to T
FTB23718 21328417 G to A
FTB23719 14333594 T to C
FTB23720 12317417 A to G
FTB23721 8870414 A to T
FTB23722 17170169 A to C
FTB23723 14483606 T to C
FTB23724 12538247 G to C
FTB23725 9303741 G to A
FTB23726 19730551 A to G
FTB23727 16661606 A to G
FTB23728 15249509 A to G
FTB23729 15740768 T to C
FTB23730 19572003 C to A
FTB23731 21670592 C to A
FTB23732 7775978 C to G
FTB23733 16628033 T to C
FTB23734 2790512 G to C
FTB23735 20409165 T to A
FTB23736 9567857 A to C
FTB23737 15905583 T to C
FTB23738 8550411 C to A
FTB23739 12028111 G to C
FTB23740 14791694 C to A
FTB23741 14765844 A to T
FTB23742 8821186 G to T
FTB23743 16645844 G to T
FTB23744 13653611 C to T
FTB23745 14606213 T to C
FTB23746 19601673 A to G
FTB23747 17259657 G to T
FTB23748 7687394 T to G
FTB23749 7183246 C to T
FTB23750 19099159 C to T
FTB23751 8632484 G to A
FTB23752 12316398 T to A
FTB23753 20755388 G to A
FTB23754 14733212 T to C
FTB23755 8821568 T to C
FTB23756 2855182 C to T
FTB23757 12955204 G to A
FTB23758 8170962 C to T
FTB23759 14761258 A to T
FTB23760 15414958 G to C
FTB23761 15438762 G to A
FTB23762 7119780 C to T
FTB23763 20991657 T to C
FTB23764 21047250 C to A
FTB23765 16436028 G to T
FTB23766 13204659 T to C
FTB23767 13227849 C to A
FTB23768 14901698 A to C
FTB23769 15999636 G to C
FTB23770 8151629 G to C
FTB23771 16579795 G to A
FTB23772 18662208 A to C
FTB23773 21460043 T to G
FTB23774 21597909 A to T
FTB23775 19735455 C to T
FTB23776 9324552 C to G
FTB23777 7792268 C to G
FTB23778 18678347 T to A
FTB23779 12724973 T to C
FTB23780 15858440 G to A
FTB23781 19000294 C to G
FTB23782 16651247 A to G
FTB23783 20392753 G to A
FTB23784 26543537 A to T
FTB23785 7733611 G to T
FTB23786 18668284 C to T
FTB23787 21103144 A to C
FTB23788 8683858 T to G
FTB23789 21588136 A to C
FTB23790 19620964 C to A
FTB23791 7688769 G to A
FTB23792 14171293 A to G
FTB23793 13490198 T to G
FTB23794 2970923 G to T
FTB23795 14485850 T to A
FTB23796 15229614 C to A
FTB23797 17167660 A to G
FTB23798 13646050 T to C
FTB23799 21638388 T to C
FTB23800 12239398 C to T
FTB23801 20446392 C to T
FTB23802 21606643 A to C
FTB23803 15324612 G to C
FTB23804 2788136 A to C
FTB23805 17116164 G to T
FTB23806 15862885 G to A
FTB23807 2897849 C to T
FTB23808 15293024 C to T
FTB23809 7075639 T to A
FTB23810 16306361 A to G
FTB23811 21032493 T to A
FTB23812 14308580 C to T
FTB23813 16303530 A to T
FTB23814 18658940 T to G
FTB23815 13407950 T to C
FTB23816 15556390 A to G
FTB23817 20792060 G to A
FTB23818 26313760 A to G
FTB23819 15327917 T to C
FTB23820 8622190 T to C
FTB23821 20804512 C to G
FTB23822 13853657 C to A
FTB23823 21454366 G to C
FTB23824 14296859 G to C
FTB23825 19004061 G to T
FTB23826 20484820 A to G
FTB23827 7198247 G to C
FTB23828 12241526 A to G
FTB23829 8531287 G to A
FTB23830 20991001 C to T
FTB23831 19016632 G to C
FTB23832 19587352 A to G
FTB23833 7697736 C to T
FTB23834 21460122 C to G
FTB23835 12442456 A to G
FTB23836 13583081 G to T
FTB23837 20515498 A to G
FTB23838 14649981 C to T
FTB23839 19909823 C to G
FTB23840 14815911 T to G
FTB23841 15228620 G to T
FTB23842 12959822 G to A
FTB23843 20905977 G to C
FTB23844 16480919 G to A
FTB23845 14680111 C to G
FTB23846 14834234 A to C
FTB23847 22268619 C to G
FTB23848 16272074 G to A
FTB23849 21412864 T to C
FTB23850 21412870 T to C
FTB23851 20591828 G to C
FTB23852 17101194 A to G
FTB23853 15160975 T to A
FTB23854 8762177 G to A
FTB23855 19251595 G to C
FTB23856 8930441 G to C
FTB23857 15324917 A to G
FTB23858 18651760 T to C
FTB23859 15220032 A to G
FTB23860 21192633 T to C
FTB23861 12913020 A to G
FTB23862 15931403 A to G
FTB23863 15544867 C to A
FTB23864 20024677 C to A
FTB23865 20998017 C to A
FTB23866 8192992 A to G
FTB23867 8280958 C to T
FTB23868 7891494 C to T
FTB23869 8530640 T to C
FTB23870 7988876 G to C
FTB23871 20756307 T to A
FTB23872 8693153 A to G
FTB23873 20811816 C to A
FTB23874 20756306 A to T
FTB23875 11987456 G to A
FTB23876 8762190 G to C
FTB23877 8690900 A to G
FTB23878 7008785 G to A
FTB23879 8215934 A to G
FTB23880 17285451 A to T
FTB23881 14392911 G to A
FTB23882 18667499 G to C
FTB23883 15979055 T to G
FTB23884 17343265 A to G
FTB23885 18667599 A to G
FTB23886 14393327 A to T
FTB23887 16568420 G to A
FTB23888 15569369 T to C
FTB23889 21595670 G to C
FTB23890 17309620 C to T
FTB23891 14187515 G to A
FTB23892 8186030 A to G
FTB23893 20547741 T to C
FTB23894 16451683 A to G
FTB23895 16849330 C to T
FTB23896 11961979 G to A
FTB23897 7704122 C to T
FTB23898 11972815 T to G
FTB23899 14769127 A to G
FTB23900 20537479 C to T
FTB23901 19261684 G to T
FTB23902 12442773 C to T
FTB23903 19303714 C to T
FTB23904 13760738 G to A
FTB23905 12547860 T to C
FTB23906 20519336 A to C
FTB23907 21696918 G to A
FTB23908 16957942 A to C
FTB23909 7528137 G to T
FTB23910 19615378 G to A
FTB23911 21353509 A to G
FTB23912 15444692 C to T
FTB23913 7933674 A to G
FTB23914 15297898 C to G
FTB23915 21363633 C to G
FTB23916 8802484 A to G
FTB23917 21711581 T to A
FTB23918 20518566 C to A
FTB23919 13302031 G to A
FTB23920 19775218 C to T
FTB23921 11968101 G to A
FTB23922 16000108 C to T
FTB23923 21818908 G to T
FTB23924 7746421 C to G
FTB23925 20664662 C to T
FTB23926 15502498 A to T
FTB23927 15328874 C to T
FTB23928 7093286 A to G
FTB23929 16934874 C to G
FTB23930 21386834 C to A
FTB23931 7496736 G to A
FTB23932 12779508 G to T
FTB23933 16663937 T to C
FTB23934 12920564 A to C
FTB23935 12928107 G to A
FTB23936 12081874 A to G
FTB23937 8691544 G to A
FTB23938 11972128 G to A
FTB23939 19431411 G to T
FTB23940 12404837 A to G
FTB23941 15931481 G to T
FTB23942 19449108 C to T
FTB23943 19317212 G to T
FTB23944 16824261 T to A
FTB23945 8131588 T to C
FTB23946 20860561 G to T
FTB23947 20861462 T to C
FTB23948 22329705 A to G
FTB23949 12280042 G to T
FTB23950 8677718 G to A
FTB23951 8677527 G to C
FTB23952 15931722 A to G
FTB23953 16827843 A to T
FTB23954 19480512 T to C
FTB23955 9031177 C to A
FTB23956 20952497 G to A
FTB23957 6915565 T to C
FTB23958 12005501 T to C
FTB23959 12102442 G to C
FTB23960 8258622 A to G
FTB23961 19487551 C to T
FTB23962 19487934 G to C
FTB23963 20745513 C to T
FTB23964 9127911 C to T
FTB23965 16552205 G to A
FTB23966 15458259 T to A
FTB23967 16769961 C to T
FTB23968 12006277 G to A
FTB23969 7999325 G to C
FTB23970 13156267 A to T
FTB23971 19540642 A to G
FTB23972 21034093 C to T
FTB23973 12914296 C to G
FTB23974 15466977 A to G
FTB23975 9131644 G to A
FTB23976 21082067 G to C
FTB23977 16554037 T to C
FTB23978 21087300 G to T
FTB23979 7658484 T to C
FTB23980 26352055 C to G
FTB23981 2864541 C to T
FTB23982 6874256 T to G
FTB23983 26352583 C to T
FTB23984 19560594 T to G
FTB23985 13857513 G to A
FTB23986 13858319 A to G
FTB23987 12127491 T to G
FTB23988 19292646 C to A
FTB23989 17181356 G to T
FTB23990 12076670 T to C
FTB23991 21264008 G to T
FTB23992 14848143 G to A
FTB23993 8365485 T to G
FTB23994 14132036 G to A
FTB23995 17343872 G to C
FTB23996 21326144 T to A
FTB23997 17345253 C to G
FTB23998 13884311 G to A
FTB23999 15994276 C to T
FTB24000 9173110 A to T
FTB24001 15584088 G to T
FTB24002 16444977 C to T
FTB24003 12896569 A to G
FTB24004 19601725 C to T
FTB24005 14467459 T to C
FTB24006 14119784 G to A
FTB24007 17371303 G to A
FTB24008 15200152 A to G
FTB24009 14472753 C to A
FTB24010 14473244 G to T
FTB24011 6873084 T to A
FTB24012 13341567 G to C
FTB24013 13343456 A to C
FTB24014 12889008 T to C
FTB24015 9229995 C to T
FTB24016 20044837 G to C
FTB24017 14483268 A to T
FTB24018 8561108 G to A
FTB24019 8378231 C to G
FTB24020 8231673 C to A
FTB24021 16946852 G to T
FTB24022 14968331 G to A
FTB24023 14995470 C to T
FTB24024 14486160 T to C
FTB24025 8412514 A to C
FTB24026 14490460 C to T
FTB24027 12864560 G to T
FTB24028 19704056 G to A
FTB24029 8575128 C to A
FTB24030 16711566 G to T
FTB24031 7521681 C to T
FTB24032 13787745 G to T
FTB24033 6977864 T to C
FTB24034 14498992 G to A
FTB24035 8638844 C to T
FTB24036 7015305 A to G
FTB24037 19711137 G to C
FTB24038 14296884 A to C
FTB24039 15025964 G to A
FTB24040 12663544 G to A
FTB24041 17146086 A to C
FTB24042 7765556 G to A
FTB24043 15246691 A to C
FTB24044 8772944 G to T
FTB24045 21599339 T to C
FTB24046 13702171 G to A
FTB24047 12817546 G to A
FTB24048 8590471 A to G
FTB24049 12287849 G to C
FTB24050 20542105 C to A
FTB24051 9317849 C to A
FTB24052 13464311 C to G
FTB24053 18673022 C to T
FTB24054 20525952 C to A
FTB24055 20524724 T to C
FTB24056 15191011 G to C
FTB24057 18673898 T to C
FTB24058 13765733 A to G
FTB24059 13491807 A to T
FTB24060 19741750 G to A
FTB24061 21708276 G to A
FTB24062 8598356 C to G
FTB24063 7792668 G to C
FTB24064 15062512 T to C
FTB24065 8599354 T to C
FTB24066 7793241 T to G
FTB24067 18905961 T to C
FTB24068 16614101 G to C
FTB24069 18913697 T to C
FTB24070 7100961 T to A
FTB24071 8606749 C to G
FTB24072 16464131 G to A
FTB24073 18921502 A to G
FTB24074 19842408 C to A
FTB24075 15851109 G to A
FTB24076 12285774 A to G
FTB24077 7330118 C to T
FTB24078 16482963 A to G
FTB24079 15229242 T to C
FTB24080 12758129 G to C
FTB24081 16699544 G to A
FTB24082 7719839 C to A
FTB24083 8928750 G to A
FTB24084 8929710 T to A
FTB24085 13868666 A to T
FTB24086 7518881 G to T
FTB24087 22281448 G to A
FTB24088 14250947 G to A
FTB24089 22284922 A to G
FTB24090 7540362 G to A
FTB24091 13640527 A to C
FTB24092 18997130 T to A
FTB24093 6999077 G to A
FTB24094 17095937 T to C
FTB24095 9007385 G to T
FTB24096 9007438 T to A
FTB24097 20730195 G to T
FTB24098 20737390 A to C
FTB24099 15324952 A to G
FTB24100 20745289 C to T
FTB24101 20745611 T to C
FTB24102 12918578 A to T
FTB24103 7729238 C to G
FTB24104 12919092 G to T
FTB24105 15333182 C to G
FTB24106 7729275 C to G
FTB24107 15344521 C to G
FTB24108 20756818 C to T
FTB24109 12920064 C to G
FTB24110 12920298 A to T
FTB24111 7025936 C to T
FTB24112 9013891 T to G
FTB24113 9014827 C to G
FTB24114 12934571 T to C
FTB24115 9014920 C to G
FTB24116 20780534 C to T
FTB24117 12941921 T to C
FTB24118 9017497 G to A
FTB24119 9017498 A to T
FTB24120 20799000 T to C
FTB24121 20805890 A to T
FTB24122 9020128 C to T
FTB24123 20811574 A to G
FTB24124 20815010 C to T
FTB24125 15383190 C to T
FTB24126 15385615 C to G
FTB24127 20861566 C to T
FTB24128 8530957 C to T
FTB24129 15395604 C to T
FTB24130 20872869 T to C
FTB24131 12959797 G to C
FTB24132 8532979 C to T
FTB24133 15419226 C to A
FTB24134 2825893 A to C
FTB24135 12973698 C to G
FTB24136 12975927 C to T
FTB24137 12976201 C to G
FTB24138 20952903 C to T
FTB24139 15425834 C to G
FTB24140 7734725 C to T
FTB24141 20954528 A to G
FTB24142 15438759 T to C
FTB24143 20956377 A to T
FTB24144 20959738 G to A
FTB24145 15442575 A to G
FTB24146 13026913 G to C
FTB24147 13041988 C to T
FTB24148 15444395 C to A
FTB24149 15450978 C to A
FTB24150 15451016 A to T
FTB24151 15458941 A to C
FTB24152 15459361 G to A
FTB24153 13107749 A to G
FTB24154 9128458 G to A
FTB24155 15464645 C to T
FTB24156 13155976 T to C
FTB24157 21029954 A to T
FTB24158 21046920 G to T
FTB24159 13161955 G to A
FTB24160 21082176 C to T
FTB24161 15478273 T to C
FTB24162 8550689 T to C
FTB24163 9132657 G to A
FTB24164 21135908 A to G
FTB24165 15502946 C to T
FTB24166 13228382 G to C
FTB24167 13237788 A to G
FTB24168 21152204 T to C
FTB24169 6916053 A to G
FTB24170 21192238 C to T
FTB24171 21241652 T to C
FTB24172 8552917 A to G
FTB24173 7738156 T to G
FTB24174 7738789 T to C
FTB24175 15554115 T to C
FTB24176 21265531 T to G
FTB24177 15556799 A to G
FTB24178 15558901 T to C
FTB24179 9156130 G to T
FTB24180 21305957 C to G
FTB24181 21306280 A to G
FTB24182 13249288 T to G
FTB24183 8553489 C to A
FTB24184 21311901 G to C
FTB24185 21323885 C to T
FTB24186 15574897 G to C
FTB24187 9162636 G to A
FTB24188 21332226 A to G
FTB24189 9185716 T to A
FTB24190 21335475 C to T
FTB24191 2842567 C to T
FTB24192 15594962 A to G
FTB24193 8556699 T to A
FTB24194 15607335 A to T
FTB24195 15607969 A to G
FTB24196 13275406 A to G
FTB24197 2849470 A to T
FTB24198 13275558 T to A
FTB24199 21373360 C to G
FTB24200 21377555 A to G
FTB24201 21381710 G to A
FTB24202 15630746 G to A
FTB24203 9222012 G to C
FTB24204 7041985 T to G
FTB24205 3004280 G to A
FTB24206 7752096 T to G
FTB24207 13344612 C to G
FTB24208 8560928 A to G
FTB24209 9263653 G to A
FTB24210 9267400 T to G
FTB24211 15653933 G to A
FTB24212 21412592 C to T
FTB24213 13362326 A to C
FTB24214 7063860 T to C
FTB24215 21419782 A to C
FTB24216 8565975 G to A
FTB24217 15656818 C to T
FTB24218 15657028 G to C
FTB24219 9277199 T to G
FTB24220 21434473 A to T
FTB24221 7063887 G to C
FTB24222 7064225 A to G
FTB24223 7758742 T to A
FTB24224 13390563 C to T
FTB24225 7411003 C to T
FTB24226 7064418 A to G
FTB24227 8575018 G to T
FTB24228 21450208 A to T
FTB24229 13402030 T to C
FTB24230 21450691 T to A
FTB24231 13402650 T to C
FTB24232 15697376 T to C
FTB24233 2852269 G to T
FTB24234 8580971 T to C
FTB24235 21465132 C to T
FTB24236 8581711 T to C
FTB24237 21471375 C to A
FTB24238 13412876 C to T
FTB24239 15708459 T to G
FTB24240 15708927 G to A
FTB24241 15736641 C to A
FTB24242 7768997 T to C
FTB24243 15754335 G to T
FTB24244 2869159 T to G
FTB24245 8585368 T to C
FTB24246 8589737 C to T
FTB24247 6760666 C to A
FTB24248 7418657 C to A
FTB24249 2958193 A to C
FTB24250 21638801 C to T
FTB24251 15779094 T to C
FTB24252 21679119 T to C
FTB24253 6949853 A to G
FTB24254 15783880 C to T
FTB24255 21703068 A to C
FTB24256 8597716 T to G
FTB24257 21708284 G to T
FTB24258 13513215 C to A
FTB24259 21711701 C to T
FTB24260 15806119 T to C
FTB24261 15809815 C to A
FTB24262 21817085 C to T
FTB24263 9330510 C to T
FTB24264 21820093 T to A
FTB24265 21820514 G to T
FTB24266 7078599 G to C
FTB24267 6970678 A to C
FTB24268 6971089 G to A
FTB24269 21826508 T to G
FTB24270 21826583 C to T
FTB24271 8609002 A to G
FTB24272 2869932 A to C
FTB24273 15850383 G to A
FTB24274 13583141 G to A
FTB24275 21843605 C to G
FTB24276 8609578 A to G
FTB24277 7828522 G to A
FTB24278 8614555 G to A
FTB24279 9568748 T to C
FTB24280 15905727 A to G
FTB24281 22254388 G to A
FTB24282 9569525 A to C
FTB24283 6792535 T to G
FTB24284 6975334 T to C
FTB24285 15917131 G to T
FTB24286 15917320 T to G
FTB24287 2871339 A to T
FTB24288 7850583 A to C
FTB24289 7850944 A to G
FTB24290 22297130 T to C
FTB24291 15920860 G to A
FTB24292 22299634 T to G
FTB24293 22307010 T to C
FTB24294 7851078 C to A
FTB24295 15923070 A to T
FTB24296 7087370 C to T
FTB24297 15931410 G to T
FTB24298 22318459 A to G
FTB24299 22329709 T to C
FTB24300 13689128 C to A
FTB24301 13690621 G to C
FTB24302 13691003 T to C
FTB24303 9997560 G to A
FTB24304 15954233 A to G
FTB24305 10000940 A to T
FTB24306 26485540 C to A
FTB24307 26486291 C to T
FTB24308 26509973 T to C
FTB24309 13703008 G to T
FTB24310 26543253 G to T
FTB24311 8626084 G to A
FTB24312 26572743 C to G
FTB24313 26595747 G to T
FTB24314 15707669 A to G
FTB24315 8626788 C to T
FTB24316 7463222 G to A
FTB24317 15993774 G to A
FTB24318 15993943 T to A
FTB24319 13735158 A to T
FTB24320 10009560 T to C
FTB24321 10013679 C to T
FTB24322 7901755 G to C
FTB24323 13750865 A to C
FTB24324 7901911 T to C
FTB24325 16050048 C to T
FTB24326 16051166 T to G
FTB24327 16055457 A to T
FTB24328 16055720 A to G
FTB24329 6983589 A to C
FTB24330 7902301 A to G
FTB24331 13760247 C to T
FTB24332 7088562 C to T
FTB24333 13765267 T to C
FTB24334 6991672 A to G
FTB24335 10037982 G to A
FTB24336 7904528 G to A
FTB24337 11761445 A to C
FTB24338 16106073 C to G
FTB24339 7911736 A to G
FTB24340 16111269 A to T
FTB24341 16111474 A to G
FTB24342 8650314 A to G
FTB24343 7484328 T to C
FTB24344 16140603 T to C
FTB24345 16152910 T to A
FTB24346 16281732 A to G
FTB24347 13818449 A to C
FTB24348 16288727 A to C
FTB24349 8666045 C to G
FTB24350 16293144 A to G
FTB24351 13843925 C to T
FTB24352 13844806 A to T
FTB24353 16435940 C to T
FTB24354 16440848 C to T
FTB24355 7507675 C to T
FTB24356 8667749 G to T
FTB24357 13864520 T to C
FTB24358 13865770 T to C
FTB24359 11897245 T to C
FTB24360 7518471 G to A
FTB24361 7959328 T to C
FTB24362 16471546 T to C
FTB24363 16474387 G to C
FTB24364 7987624 C to G
FTB24365 11916276 A to G
FTB24366 13872839 C to A
FTB24367 11923125 G to A
FTB24368 16483033 G to T
FTB24369 13882706 T to C
FTB24370 16489414 A to T
FTB24371 16496511 C to T
FTB24372 7987724 A to G
FTB24373 16508340 C to T
FTB24374 13884495 A to G
FTB24375 16529214 A to T
FTB24376 13886077 G to T
FTB24377 7987730 C to T
FTB24378 16564996 G to T
FTB24379 13928733 T to G
FTB24380 11960707 C to T
FTB24381 16568362 T to C
FTB24382 16571989 G to C
FTB24383 13930800 C to G
FTB24384 16573599 C to T
FTB24385 11961760 C to T
FTB24386 16582220 T to G
FTB24387 11962187 C to T
FTB24388 11968063 A to C
FTB24389 16589104 A to G
FTB24390 14062067 A to G
FTB24391 8024793 T to C
FTB24392 8094664 C to A
FTB24393 11970529 C to A
FTB24394 14082553 T to C
FTB24395 16649554 G to A
FTB24396 16654148 T to C
FTB24397 16661883 A to G
FTB24398 16666263 G to A
FTB24399 16695678 T to A
FTB24400 11972663 T to C
FTB24401 14093477 G to A
FTB24402 8689572 C to T
FTB24403 11973020 T to C
FTB24404 16727416 C to A
FTB24405 14124833 G to T
FTB24406 16740694 A to G
FTB24407 14135259 G to T
FTB24408 6836334 T to C
FTB24409 7529808 A to G
FTB24410 8692453 T to C
FTB24411 7530788 C to T
FTB24412 16798350 A to T
FTB24413 16805173 C to A
FTB24414 8697765 G to A
FTB24415 16829389 T to C
FTB24416 14143578 G to T
FTB24417 16849358 T to C
FTB24418 14143970 G to A
FTB24419 16879953 A to G
FTB24420 16881817 A to G
FTB24421 16882190 A to G
FTB24422 8698558 G to A
FTB24423 12006791 A to G
FTB24424 16892190 G to A
FTB24425 7533469 C to T
FTB24426 2963994 A to G
FTB24427 7540074 T to G
FTB24428 14168813 G to A
FTB24429 16946650 T to C
FTB24430 14175635 G to A
FTB24431 12016644 T to C
FTB24432 8706514 A to G
FTB24433 7102396 C to T
FTB24434 12017670 C to T
FTB24435 16964375 A to G
FTB24436 8153012 A to G
FTB24437 12018733 C to A
FTB24438 12019156 C to A
FTB24439 12028056 A to G
FTB24440 16978203 A to T
FTB24441 16978232 T to G
FTB24442 16981174 C to A
FTB24443 16983659 T to A
FTB24444 14236614 T to C
FTB24445 14246912 C to G
FTB24446 12028117 C to A
FTB24447 7552832 C to T
FTB24448 17036010 G to A
FTB24449 8716712 G to A
FTB24450 12030895 G to A
FTB24451 14265566 T to C
FTB24452 2964741 A to T
FTB24453 7102744 A to G
FTB24454 17054972 C to T
FTB24455 17058453 G to A
FTB24456 8719982 T to C
FTB24457 14277083 A to G
FTB24458 17087577 C to A
FTB24459 17101210 G to A
FTB24460 12056968 C to T
FTB24461 14280779 T to C
FTB24462 14290445 A to G
FTB24463 12068292 A to G
FTB24464 17128708 T to C
FTB24465 14297946 T to G
FTB24466 17150239 G to A
FTB24467 17157385 A to T
FTB24468 14303897 C to T
FTB24469 12069149 C to T
FTB24470 7114683 C to T
FTB24471 17170244 C to A
FTB24472 8165178 A to T
FTB24473 14328119 A to G
FTB24474 8169324 A to C
FTB24475 14337892 G to A
FTB24476 12081405 A to C
FTB24477 14341503 A to G
FTB24478 17231604 G to T
FTB24479 12085076 T to C
FTB24480 17245935 G to C
FTB24481 14361133 T to G
FTB24482 17255766 C to G
FTB24483 17255910 C to T
FTB24484 7117174 T to C
FTB24485 14365810 A to T
FTB24486 14366029 T to C
FTB24487 17271774 G to A
FTB24488 7117756 C to T
FTB24489 7639714 G to A
FTB24490 12088570 C to T
FTB24491 12088817 T to A
FTB24492 12102743 T to A
FTB24493 8737757 G to A
FTB24494 17328089 G to T
FTB24495 17328244 A to G
FTB24496 17328659 A to C
FTB24497 8743441 A to T
FTB24498 14411824 G to A
FTB24499 8746940 C to G
FTB24500 17330944 T to C
FTB24501 17331074 G to T
FTB24502 7122663 C to A
FTB24503 7122773 T to C
FTB24504 7125863 C to G
FTB24505 17345278 G to T
FTB24506 17359422 A to G
FTB24507 14467778 T to C
FTB24508 14480430 T to C
FTB24509 17399463 G to A
FTB24510 17399711 A to G
FTB24511 17399787 G to A
FTB24512 8230930 C to T
FTB24513 18647137 C to T
FTB24514 18659096 A to C
FTB24515 7661238 A to G
FTB24516 14538698 T to G
FTB24517 8766083 C to A
FTB24518 14549567 T to C
FTB24519 18672867 C to T
FTB24520 7127373 T to C
FTB24521 7127563 A to C
FTB24522 18872095 G to A
FTB24523 14557196 T to A
FTB24524 12205817 T to A
FTB24525 14581701 A to G
FTB24526 14582850 T to C
FTB24527 18913437 C to G
FTB24528 18918536 C to T
FTB24529 18918579 C to T
FTB24530 18919076 C to G
FTB24531 18921557 A to G
FTB24532 14583232 T to C
FTB24533 18975062 T to A
FTB24534 18975063 C to G
FTB24535 7142775 T to C
FTB24536 7679780 A to C
FTB24537 7679782 T to A
FTB24538 7145927 G to A
FTB24539 18995961 A to G
FTB24540 18997806 T to C
FTB24541 12225015 C to G
FTB24542 19000732 G to T
FTB24543 12228314 T to A
FTB24544 14621889 A to G
FTB24545 19015843 G to A
FTB24546 14624245 A to C
FTB24547 8778681 G to T
FTB24548 19017771 T to C
FTB24549 14629258 A to G
FTB24550 7000420 A to G
FTB24551 7684505 T to C
FTB24552 19063758 G to A
FTB24553 8796328 C to T
FTB24554 14643273 G to A
FTB24555 7685535 G to C
FTB24556 19067818 C to A
FTB24557 14647709 T to C
FTB24558 14649498 G to T
FTB24559 19071991 C to A
FTB24560 19129237 G to T
FTB24561 8812512 C to T
FTB24562 8270991 C to A
FTB24563 14664190 A to C
FTB24564 14675241 G to T
FTB24565 14676856 T to A
FTB24566 19197696 C to A
FTB24567 19212296 G to T
FTB24568 14677005 T to C
FTB24569 19260827 G to C
FTB24570 8816377 C to T
FTB24571 19261264 G to T
FTB24572 19264647 C to T
FTB24573 8817559 T to C
FTB24574 19272278 G to C
FTB24575 14692866 T to C
FTB24576 14694014 C to T
FTB24577 14694932 C to G
FTB24578 12341205 G to C
FTB24579 12348564 T to C
FTB24580 12356858 G to A
FTB24581 7000509 G to A
FTB24582 14712958 C to A
FTB24583 12368346 C to A
FTB24584 19303578 G to A
FTB24585 19304124 G to A
FTB24586 14727238 G to A
FTB24587 14733769 G to A
FTB24588 19319041 G to A
FTB24589 12386903 A to T
FTB24590 14743637 T to A
FTB24591 14744877 C to G
FTB24592 19329970 A to T
FTB24593 14745033 G to A
FTB24594 8827571 G to C
FTB24595 14749249 G to A
FTB24596 8828598 A to G
FTB24597 14750636 A to T
FTB24598 19456123 G to C
FTB24599 8281431 T to C
FTB24600 14761225 T to C
FTB24601 14761313 G to A
FTB24602 19465639 T to C
FTB24603 19466565 G to A
FTB24604 14765864 C to T
FTB24605 14766477 T to C
FTB24606 2971011 G to A
FTB24607 19481893 T to C
FTB24608 19482574 T to G
FTB24609 12430552 A to C
FTB24610 19484621 C to A
FTB24611 14788238 T to A
FTB24612 14791357 A to G
FTB24613 8840963 T to C
FTB24614 19506510 C to T
FTB24615 19521118 T to C
FTB24616 19522202 T to G
FTB24617 19522857 G to A
FTB24618 19539033 G to C
FTB24619 12431721 T to C
FTB24620 8841759 T to C
FTB24621 12489331 G to C
FTB24622 8841960 T to C
FTB24623 8842730 A to G
FTB24624 19567063 T to G
FTB24625 12528036 T to A
FTB24626 19568487 T to C
FTB24627 7697326 C to A
FTB24628 12535769 A to G
FTB24629 14850630 T to C
FTB24630 19591739 A to T
FTB24631 7200821 C to A
FTB24632 12540051 A to G
FTB24633 19598020 T to C
FTB24634 7203520 G to C
FTB24635 7305096 T to C
FTB24636 12543566 C to A
FTB24637 14897498 A to G
FTB24638 19614318 C to T
FTB24639 14907054 T to C
FTB24640 14918127 T to C
FTB24641 19620957 T to C
FTB24642 19638744 T to G
FTB24643 19646086 G to A
FTB24644 14921213 A to C
FTB24645 19646779 T to G
FTB24646 14937332 C to G
FTB24647 12594761 T to A
FTB24648 8881642 G to A
FTB24649 7305118 T to G
FTB24650 19676364 G to A
FTB24651 19676581 G to A
FTB24652 19680091 A to T
FTB24653 12610777 G to A
FTB24654 19681059 T to A
FTB24655 19682354 G to C
FTB24656 8886307 G to A
FTB24657 7305484 C to A
FTB24658 12618941 T to G
FTB24659 15007530 T to C
FTB24660 19710706 T to C
FTB24661 15007941 C to T
FTB24662 19715453 C to T
FTB24663 19715797 C to G
FTB24664 19732542 T to C
FTB24665 8891410 A to G
FTB24666 15036187 T to G
FTB24667 19735602 A to G
FTB24668 19736507 C to T
FTB24669 12692315 T to C
FTB24670 12700209 C to G
FTB24671 15056547 C to T
FTB24672 19741525 C to A
FTB24673 19741600 T to C
FTB24674 15057039 T to C
FTB24675 12701696 T to A
FTB24676 19742060 T to C
FTB24677 12708408 T to C
FTB24678 7713565 A to G
FTB24679 19764671 T to C
FTB24680 19776441 A to G
FTB24681 2855771 A to G
FTB24682 15076072 G to A
FTB24683 15076540 T to C
FTB24684 15077905 G to A
FTB24685 7319073 A to G
FTB24686 7325936 C to T
FTB24687 12739913 T to A
FTB24688 12739921 A to G
FTB24689 19842789 A to T
FTB24690 8479748 C to A
FTB24691 8479867 A to G
FTB24692 19909850 T to C
FTB24693 8925915 A to C
FTB24694 19977504 G to C
FTB24695 19978941 C to T
FTB24696 15144424 C to T
FTB24697 7336228 A to G
FTB24698 19987427 T to C
FTB24699 15161454 A to G
FTB24700 8931439 G to T
FTB24701 15174962 A to C
FTB24702 20024154 T to A
FTB24703 20024403 A to G
FTB24704 2788403 C to A
FTB24705 8497142 C to T
FTB24706 20044780 C to T
FTB24707 15183479 A to G
FTB24708 8497398 C to T
FTB24709 15189544 T to A
FTB24710 15190775 T to C
FTB24711 15191085 C to T
FTB24712 20397456 T to A
FTB24713 8499096 G to A
FTB24714 7359727 T to A
FTB24715 15196378 G to A
FTB24716 15196509 G to A
FTB24717 7377170 T to C
FTB24718 7018089 A to G
FTB24719 15201098 A to C
FTB24720 15213738 A to G
FTB24721 2883763 T to G
FTB24722 20442819 T to C
FTB24723 7377367 G to A
FTB24724 15224186 A to G
FTB24725 20464284 T to A
FTB24726 7727594 C to A
FTB24727 20465626 G to A
FTB24728 8508582 G to A
FTB24729 15229255 G to T
FTB24730 20510341 A to C
FTB24731 20510742 A to C
FTB24732 20511306 T to C
FTB24733 20511894 T to G
FTB24734 20516696 C to A
FTB24735 12809991 T to C
FTB24736 7728495 T to C
FTB24737 8512965 A to C
FTB24738 8995744 T to C
FTB24739 20544018 G to C
FTB24740 9002935 T to C
FTB24741 8514347 C to T
FTB24742 15249514 T to A
FTB24743 9003184 C to T
FTB24744 2847286 C to G
FTB24745 12857771 C to G
FTB24746 8516666 C to T
FTB24747 20563404 G to T
FTB24748 12862372 C to T
FTB24749 8516874 G to A
FTB24750 12864715 A to T
FTB24751 12866967 A to C
FTB24752 12888788 C to T
FTB24753 20661423 A to G
FTB24754 20666434 G to T
FTB24755 20669110 T to G
FTB24756 12892799 G to T
FTB24757 20674360 A to G
FTB24758 20696540 C to T
FTB24759 20696678 A to C
FTB24760 15305046 T to C
FTB24761 20700050 C to G
FTB24762 9005017 G to C
FTB24763 15307043 A to T
FTB24764 12909659 T to G
FTB24765 7729126 T to C
FTB24766 20727806 G to C
FTB24767 15091340 T to C
FTB24768 15092859 C to A
FTB24769 15122691 G to C
FTB24770 15122768 T to C
FTB24771 15123852 G to C
FTB24772 15123968 A to T
FTB24773 15124918 G to C
FTB24774 15160182 C to A
FTB24775 15173487 G to A
FTB24776 15174178 G to A
FTB24777 15175304 T to C
FTB24778 15183157 A to G
FTB24779 15186397 G to A
FTB24780 15193633 G to A
FTB24781 15194234 T to C
FTB24782 15197112 A to G
FTB24783 15200593 C to A
FTB24784 15215521 C to T
FTB24785 15216028 C to T
FTB24786 15220074 A to G
FTB24787 15228204 C to A
FTB24788 15228567 T to C
FTB24789 15229774 G to A
FTB24790 15234931 T to A
FTB24791 15235091 A to G
FTB24792 15235328 A to G
FTB24793 15239731 G to A
FTB24794 15240007 T to C
FTB24795 15246295 C to T
FTB24796 15276206 C to G
FTB24797 15276725 T to G
FTB24798 15282769 G to C
FTB24799 15286389 A to G
FTB24800 15287374 T to C
FTB24801 15287606 T to A
FTB24802 15287891 C to T
FTB24803 15291089 G to A
FTB24804 15292390 C to A
FTB24805 15292793 G to A
FTB24806 15293964 C to A
FTB24807 15297956 C to T
FTB24808 15303998 T to G
FTB24809 15306674 C to T
FTB24810 15307210 C to T
FTB24811 15309366 G to A
FTB24812 15309510 G to A
FTB24813 15311639 T to C
FTB24814 15323876 T to C
FTB24815 15326976 T to C
FTB24816 15330649 G to A
FTB24817 15331540 C to T
FTB24818 15331612 C to T
FTB24819 15333929 T to C
FTB24820 15345604 G to T
FTB24821 15348039 C to A
FTB24822 15353073 G to A
FTB24823 15353173 C to G
FTB24824 15357686 A to C
FTB24825 15364299 C to T
FTB24826 15367023 C to A
FTB24827 15375208 C to A
FTB24828 15375456 A to T
FTB24829 15375536 G to A
FTB24830 15375991 A to G
FTB24831 15380736 G to A
FTB24832 15380813 C to A
FTB24833 15381109 A to C
FTB24834 15381842 T to C
FTB24835 15382093 A to G
FTB24836 15395192 G to T
FTB24837 15397882 G to A
FTB24838 15398215 G to A
FTB24839 15405591 G to A
FTB24840 15406375 C to A
FTB24841 15419439 G to A
FTB24842 15420638 C to A
FTB24843 15420991 G to A
FTB24844 15421549 A to G
FTB24845 15425233 G to T
FTB24846 15425625 A to G
FTB24847 15425672 T to G
FTB24848 15425862 A to G
FTB24849 15443158 A to C
FTB24850 15444307 C to A
FTB24851 15444689 G to A
FTB24852 15459534 A to G
FTB24853 15461606 T to C
FTB24854 15461775 G to A
FTB24855 15464821 T to C
FTB24856 15465964 G to A
FTB24857 15467215 C to A
FTB24858 15471834 A to G
FTB24859 15479177 T to C
FTB24860 15481199 C to A
FTB24861 15482913 A to G
FTB24862 15486550 G to C
FTB24863 15502760 A to T
FTB24864 15541733 C to A
FTB24865 15543338 A to C
FTB24866 15544354 T to C
FTB24867 15552372 A to G
FTB24868 15552373 G to A
FTB24869 15553355 T to C
FTB24870 15559059 C to G
FTB24871 15559238 T to C
FTB24872 15562885 A to G
FTB24873 15578115 G to A
FTB24874 15578595 G to A
FTB24875 15591939 G to T
FTB24876 15592494 T to C
FTB24877 15592771 T to C
FTB24878 15606747 T to A
FTB24879 15609579 G to C
FTB24880 15609842 C to T
FTB24881 15624190 G to A
FTB24882 15624282 C to A
FTB24883 15630298 C to T
FTB24884 15631774 G to T
FTB24885 15635023 A to C
FTB24886 15635972 G to C
FTB24887 15640469 A to G
FTB24888 15643095 G to A
FTB24889 15643095 G to T
FTB24890 15646535 G to A
FTB24891 15648845 T to C
FTB24892 15650403 T to C
FTB24893 15652914 T to C
FTB24894 15653366 T to C
FTB24895 15653432 G to A
FTB24896 15654180 T to A
FTB24897 15654741 A to C
FTB24898 15656785 G to A
FTB24899 15660229 C to A
FTB24900 15668408 G to A
FTB24901 15669165 C to T
FTB24902 15670537 A to T
FTB24903 15688223 A to G
FTB24904 15688653 T to C
FTB24905 15688822 A to G
FTB24906 15689801 G to A
FTB24907 15690088 G to C
FTB24908 15691969 A to C
FTB24909 15696838 C to T
FTB24910 15699453 T to C
FTB24911 15702124 C to T
FTB24912 15702272 A to T
FTB24913 15702531 T to C
FTB24914 15704377 T to C
FTB24915 15707820 C to T
FTB24916 15731681 T to G
FTB24917 15736448 A to G
FTB24918 15754143 T to G
FTB24919 15754382 G to T
FTB24920 15759405 A to G
FTB24921 15762750 G to A
FTB24922 15766574 T to C
FTB24923 15767048 C to A
FTB24924 15767157 G to A
FTB24925 15769571 T to C
FTB24926 15770114 G to A
FTB24927 15770588 A to C
FTB24928 15779526 G to A
FTB24929 15780184 C to A
FTB24930 15783851 G to A
FTB24931 15785191 T to A
FTB24932 15793137 C to G
FTB24933 15793277 G to C
FTB24934 15794938 A to G
FTB24935 15795587 C to T
FTB24936 15805294 C to T
FTB24937 15805607 A to C
FTB24938 15805726 A to G
FTB24939 15806311 G to C
FTB24940 15815294 G to A
FTB24941 15825718 G to A
FTB24942 15826070 G to T
FTB24943 15826123 T to G
FTB24944 15837189 G to A
FTB24945 15845389 T to G
FTB24946 15845881 T to A
FTB24947 15846201 C to A
FTB24948 15859131 A to G
FTB24949 15864944 A to C
FTB24950 15865187 C to A
FTB24951 15866047 T to A
FTB24952 15868689 G to T
FTB24953 15869189 A to T
FTB24954 15870530 T to A
FTB24955 15870659 A to C
FTB24956 15911042 C to G
FTB24957 15916152 G to A
FTB24958 15916185 A to C
FTB24959 15917556 G to T
FTB24960 15917713 T to A
FTB24961 15919957 C to G
FTB24962 15920530 G to A
FTB24963 15920720 G to C
FTB24964 15920939 C to T
FTB24965 15922484 T to C
FTB24966 15922930 T to C
FTB24967 15931333 C to T
FTB24968 15931811 A to T
FTB24969 15932737 A to C
FTB24970 15934595 T to C
FTB24971 15937273 G to A
FTB24972 15938027 G to A
FTB24973 15940209 A to G
FTB24974 15955194 G to T
FTB24975 15955214 G to C
FTB24976 15970394 C to T
FTB24977 15971811 T to A
FTB24978 15972522 G to T
FTB24979 15979653 T to C
FTB24980 15980030 T to C
FTB24981 15981360 G to A
FTB24982 15987548 A to T
FTB24983 15993961 A to C
FTB24984 15994012 G to C
FTB24985 15999687 G to C
FTB24986 16000122 T to C
FTB24987 16010821 C to T
FTB24988 16014438 A to T
FTB24989 16014439 T to C
FTB24990 16032518 C to A
FTB24991 16036788 T to C
FTB24992 16038304 C to G
FTB24993 16051030 T to G
FTB24994 16058223 C to G
FTB24995 16058512 C to T
FTB24996 16058650 T to A
FTB24997 16059063 A to C
FTB24998 16063013 C to T
FTB24999 16063083 T to C
FTB25000 16063519 G to C
FTB25001 16064285 C to A
FTB25002 16081243 T to G
FTB25003 16090931 C to T
FTB25004 16092104 G to A
FTB25005 16106002 T to C
FTB25006 16111116 T to G
FTB25007 16122618 C to T
FTB25008 16140460 A to G
FTB25009 16147010 A to G
FTB25010 16271491 C to T
FTB25011 16271625 A to T
FTB25012 16275870 T to C
FTB25013 16281970 C to T
FTB25014 16292789 G to T
FTB25015 16293076 C to T
FTB25016 16294036 T to C
FTB25017 16303014 A to G
FTB25018 16303421 G to C
FTB25019 16308892 T to C
FTB25020 16436062 G to A
FTB25021 16439746 C to T
FTB25022 16440875 A to G
FTB25023 16448461 C to A
FTB25024 16451237 A to G
FTB25025 16458906 T to C
FTB25026 16459217 A to G
FTB25027 16459757 C to A
FTB25028 16466649 C to A
FTB25029 16466751 A to G
FTB25030 16474641 T to C
FTB25031 16474687 G to A
FTB25032 16474700 T to C
FTB25033 16475817 A to G
FTB25034 16486846 C to G
FTB25035 16499132 C to A
FTB25036 16507942 G to A
FTB25037 16508030 G to T
FTB25038 16528152 A to G
FTB25039 16529350 A to G
FTB25040 16537044 T to C
FTB25041 16537538 T to C
FTB25042 16545327 G to T
FTB25043 16548816 T to C
FTB25044 16552318 C to A
FTB25045 16553881 C to A
FTB25046 16567046 T to C
FTB25047 16567657 T to G
FTB25048 16572314 C to T
FTB25049 16579341 G to A
FTB25050 16582347 A to C
FTB25051 16585067 C to T
FTB25052 16588176 T to C
FTB25053 16601393 C to T
FTB25054 16601593 A to G
FTB25055 16603140 A to G
FTB25056 16614246 G to A
FTB25057 16620453 T to A
FTB25058 16624672 A to T
FTB25059 16628196 A to G
FTB25060 16628775 T to G
FTB25061 16633168 G to A
FTB25062 16649173 C to G
FTB25063 16651563 A to C
FTB25064 16662192 T to A
FTB25065 16662248 G to C
FTB25066 16699667 G to A
FTB25067 16701221 G to A
FTB25068 16701225 C to A
FTB25069 16709923 A to C
FTB25070 16710688 G to C
FTB25071 16712467 T to C
FTB25072 16712932 C to T
FTB25073 16730990 T to A
FTB25074 16740610 C to A
FTB25075 16773204 A to G
FTB25076 16773396 C to T
FTB25077 16773397 T to A
FTB25078 16776789 T to C
FTB25079 16784348 T to C
FTB25080 16787590 C to G
FTB25081 16795211 C to T
FTB25082 16808723 G to A
FTB25083 16823269 T to C
FTB25084 16826654 T to A
FTB25085 16827311 C to A
FTB25086 16829497 G to A
FTB25087 16830347 A to G
FTB25088 16867622 G to A
FTB25089 16871035 A to C
FTB25090 16882209 A to G
FTB25091 16889851 G to A
FTB25092 16912090 A to G
FTB25093 16912265 T to A
FTB25094 16923111 A to T
FTB25095 16923538 T to C
FTB25096 16926468 A to C
FTB25097 16927009 G to A
FTB25098 16946756 T to A
FTB25099 16947285 C to T
FTB25100 16955224 A to G
FTB25101 16956553 A to T
FTB25102 16957379 C to T
FTB25103 16957392 C to T
FTB25104 16957611 A to C
FTB25105 16957845 C to T
FTB25106 16965752 G to T
FTB25107 16967823 A to G
FTB25108 16974920 A to T
FTB25109 16975078 A to C
FTB25110 16975307 T to C
FTB25111 16994102 G to C
FTB25112 16994197 T to C
FTB25113 17006284 T to C
FTB25114 17006409 G to A
FTB25115 17006744 A to G
FTB25116 17033320 G to T
FTB25117 17035025 C to G
FTB25118 17037532 A to C
FTB25119 17037564 G to T
FTB25120 17053592 G to T
FTB25121 17054354 C to T
FTB25122 17054441 A to G
FTB25123 17059924 G to T
FTB25124 17060104 A to C
FTB25125 17096098 C to A
FTB25126 17109342 G to A
FTB25127 17112296 A to T
FTB25128 17112626 A to C
FTB25129 17116149 A to G
FTB25130 17116516 C to T
FTB25131 17120144 C to T
FTB25132 17148156 G to A
FTB25133 17148295 T to C
FTB25134 17148704 G to A
FTB25135 17162701 A to G
FTB25136 17165137 C to G
FTB25137 17167222 T to C
FTB25138 17170696 C to T
FTB25139 17171246 G to A
FTB25140 17192915 C to A
FTB25141 17192985 C to G
FTB25142 17194198 T to A
FTB25143 17194566 T to C
FTB25144 17209424 G to C
FTB25145 17224010 G to T
FTB25146 17224340 G to A
FTB25147 17231406 A to G
FTB25148 17232044 G to C
FTB25149 17245907 C to A
FTB25150 17255410 A to G
FTB25151 17262357 G to T
FTB25152 17263145 C to T
FTB25153 17269771 A to C
FTB25154 17284267 G to A
FTB25155 17292417 A to G
FTB25156 17293529 T to G
FTB25157 17293836 A to G
FTB25158 17293892 A to G
FTB25159 17302027 G to C
FTB25160 17302346 G to T
FTB25161 17308043 G to C
FTB25162 17308313 A to G
FTB25163 17309116 T to C
FTB25164 17319843 C to T
FTB25165 17320571 T to C
FTB25166 17327986 T to G
FTB25167 17328247 C to A
FTB25168 17329785 G to A
FTB25169 17330145 G to A
FTB25170 17330500 T to C
FTB25171 17330529 A to G
FTB25172 17333511 G to T
FTB25173 17339550 T to A
FTB25174 17339735 A to G
FTB25175 17340343 G to A
FTB25176 17343216 G to A
FTB25177 17345185 G to A
FTB25178 17360404 A to C
FTB25179 17370492 G to C
FTB25180 17373574 T to C
FTB25181 17378276 G to A
FTB25182 17390447 T to C
FTB25183 17399139 T to C
FTB25184 17404452 T to A
FTB25185 17427040 C to A
FTB25186 17439527 G to A
FTB25187 17454104 A to G
FTB25188 17454251 A to G
FTB25189 17454295 A to G
FTB25190 18652233 T to C
FTB25191 18652921 A to G
FTB25192 18659144 T to C
FTB25193 18666644 T to A
FTB25194 18668058 A to G
FTB25195 18668402 A to T
FTB25196 18668728 A to G
FTB25197 18670054 A to C
FTB25198 18673978 T to G
FTB25199 18674187 C to G
FTB25200 18890084 C to T
FTB25201 18891698 A to G
FTB25202 18901756 G to C
FTB25203 18912446 A to C
FTB25204 18969675 G to T
FTB25205 18979894 G to T
FTB25206 18989187 T to C
FTB25207 18989234 C to G
FTB25208 18989414 G to T
FTB25209 18998102 C to G
FTB25210 18999018 T to C
FTB25211 18999385 T to C
FTB25212 19004411 G to C
FTB25213 19006854 A to T
FTB25214 19016182 T to A
FTB25215 19016294 T to C
FTB25216 19016580 G to C
FTB25217 19022106 C to T
FTB25218 19024241 T to C
FTB25219 19025122 A to G
FTB25220 19029251 G to C
FTB25221 19048273 T to G
FTB25222 19052757 A to G
FTB25223 19062024 A to G
FTB25224 19062111 T to C
FTB25225 19063991 T to A
FTB25226 19064290 T to C
FTB25227 19064965 C to T
FTB25228 19070610 G to T
FTB25229 19070673 A to C
FTB25230 19071947 A to G
FTB25231 19072195 C to T
FTB25232 19099355 A to G
FTB25233 19099487 G to A
FTB25234 19129081 T to C
FTB25235 19130096 A to G
FTB25236 19149166 G to A
FTB25237 19149892 C to A
FTB25238 19150197 G to C
FTB25239 19168983 G to T
FTB25240 19169058 T to G
FTB25241 19172233 T to G
FTB25242 19248999 C to T
FTB25243 19260592 T to G
FTB25244 19260850 G to C
FTB25245 19261038 A to C
FTB25246 19261064 G to C
FTB25247 19268447 T to G
FTB25248 19271664 A to C
FTB25249 19278572 A to G
FTB25250 19279893 G to A
FTB25251 19280002 G to A
FTB25252 19285165 C to A
FTB25253 19291456 A to T
FTB25254 19291802 A to C
FTB25255 19298450 G to A
FTB25256 19298705 T to C
FTB25257 19298862 T to C
FTB25258 19299403 C to G
FTB25259 19304721 T to C
FTB25260 19317817 C to T
FTB25261 19317828 C to A
FTB25262 19318561 A to G
FTB25263 19319251 G to A
FTB25264 19320302 A to C
FTB25265 19320348 T to G
FTB25266 19321927 A to T
FTB25267 19322310 A to T
FTB25268 19431180 T to C
FTB25269 19448811 C to G
FTB25270 19450339 G to A
FTB25271 19452109 T to C
FTB25272 19452355 G to A
FTB25273 19456072 A to C
FTB25274 19456404 A to G
FTB25275 19456815 A to G
FTB25276 19459501 C to A
FTB25277 19460007 T to C
FTB25278 19460403 A to G
FTB25279 19465707 G to A
FTB25280 19467178 A to G
FTB25281 19474726 G to A
FTB25282 19475063 A to C
FTB25283 19481207 G to T
FTB25284 19482877 G to A
FTB25285 19484631 G to T
FTB25286 19484903 T to C
FTB25287 19496310 T to C
FTB25288 19504435 G to A
FTB25289 19521990 A to G
FTB25290 19539185 G to T
FTB25291 19540623 C to G
FTB25292 19542558 G to T
FTB25293 19549799 C to T
FTB25294 19550397 G to A
FTB25295 19554924 G to A
FTB25296 19555351 G to A
FTB25297 19555403 A to G
FTB25298 19560607 G to C
FTB25299 19562294 T to G
FTB25300 19567322 G to C
FTB25301 19568214 A to G
FTB25302 19571270 G to T
FTB25303 19572649 T to C
FTB25304 19572691 A to G
FTB25305 19577986 A to G
FTB25306 19587024 C to A
FTB25307 19588753 A to G
FTB25308 19589042 T to C
FTB25309 19589761 T to C
FTB25310 19591987 A to G
FTB25311 19597262 T to C
FTB25312 19598356 C to T
FTB25313 19598548 G to C
FTB25314 19601428 C to T
FTB25315 19601966 G to A
FTB25316 19601981 T to C
FTB25317 19603558 A to G
FTB25318 19616197 C to T
FTB25319 19616947 C to T
FTB25320 19618365 A to C
FTB25321 19618951 T to C
FTB25322 19646122 G to A
FTB25323 19646401 G to A
FTB25324 19647197 G to A
FTB25325 19650263 G to T
FTB25326 19650317 T to C
FTB25327 19650800 G to A
FTB25328 19664180 C to T
FTB25329 19675352 C to T
FTB25330 19680819 G to A
FTB25331 19681661 A to G
FTB25332 19682146 T to C
FTB25333 19682499 C to A
FTB25334 19683327 T to C
FTB25335 19704351 T to G
FTB25336 19705312 C to T
FTB25337 19707800 T to C
FTB25338 19710846 A to C
FTB25339 19711025 G to A
FTB25340 19715590 G to A
FTB25341 19720000 C to A
FTB25342 19734150 A to G
FTB25343 19734360 G to A
FTB25344 19735934 A to C
FTB25345 19736859 C to T
FTB25346 19738658 G to A
FTB25347 19739153 G to A
FTB25348 19741601 T to A
FTB25349 19741622 C to A
FTB25350 19742096 A to G
FTB25351 19755709 A to G
FTB25352 19774522 C to T
FTB25353 19776650 C to G
FTB25354 19776827 A to G
FTB25355 19813917 G to A
FTB25356 19815663 A to G
FTB25357 19816776 G to C
FTB25358 19817303 C to T
FTB25359 19841529 G to A
FTB25360 19841735 A to G
FTB25361 19841874 C to T
FTB25362 19881022 C to T
FTB25363 19881092 A to G
FTB25364 19909715 G to T
FTB25365 19911550 T to C
FTB25366 19924209 G to A
FTB25367 19924559 T to G
FTB25368 19925027 T to G
FTB25369 19947317 G to T
FTB25370 19954780 G to A
FTB25371 19980081 A to T
FTB25372 19987031 C to A
FTB25373 19987223 C to T
FTB25374 19996025 T to G
FTB25375 20016775 C to T
FTB25376 20017170 T to C
FTB25377 20018881 T to C
FTB25378 20030304 A to C
FTB25379 20030815 C to T
FTB25380 20045066 T to C
FTB25381 20052252 A to T
FTB25382 20358309 A to T
FTB25383 20377568 C to A
FTB25384 20390036 T to G
FTB25385 20395599 G to A
FTB25386 20398021 T to C
FTB25387 20406347 G to C
FTB25388 20406730 C to A
FTB25389 20408658 G to C
FTB25390 20410480 C to T
FTB25391 20411171 C to A
FTB25392 20412088 G to A
FTB25393 20413847 T to C
FTB25394 20414200 G to T
FTB25395 20414323 T to C
FTB25396 20422002 T to G
FTB25397 20426808 C to T
FTB25398 20442765 A to C
FTB25399 20447702 G to A
FTB25400 20448568 C to T
FTB25401 20464210 C to T
FTB25402 20464544 A to T
FTB25403 20485211 T to A
FTB25404 20507428 C to T
FTB25405 20507955 T to C
FTB25406 20508861 C to G
FTB25407 20517379 C to T
FTB25408 20518924 C to G
FTB25409 20519081 A to G
FTB25410 20535679 C to G
FTB25411 20538099 T to C
FTB25412 20544199 C to T
FTB25413 20544538 G to A
FTB25414 20544539 G to A
FTB25415 20549259 T to C
FTB25416 20550259 A to G
FTB25417 20554700 A to G
FTB25418 20554703 C to T
FTB25419 20555506 G to A
FTB25420 20557594 T to C
FTB25421 20563081 C to T
FTB25422 20563082 A to C
FTB25423 20578241 C to T
FTB25424 20578264 A to G
FTB25425 20578793 C to T
FTB25426 20586703 A to C
FTB25427 20588371 T to A
FTB25428 20610712 A to G
FTB25429 20622156 C to A
FTB25430 20661406 A to T
FTB25431 20664909 A to C
FTB25432 20670973 A to G
FTB25433 20673931 T to C
FTB25434 20698465 G to T
FTB25435 20701054 C to A
FTB25436 20727322 G to T
FTB25437 20727395 G to A
FTB25438 20727765 T to A
FTB25439 20727958 G to C
FTB25440 20729394 G to A
FTB25441 20730606 C to A
FTB25442 20732767 A to C
FTB25443 20735715 C to T
FTB25444 20738326 C to T
FTB25445 20744433 C to T
FTB25446 20744985 A to G
FTB25447 20745563 T to G
FTB25448 20745901 A to G
FTB25449 20747459 G to C
FTB25450 20755642 C to T
FTB25451 20755830 G to A
FTB25452 20756523 G to A
FTB25453 20756721 G to T
FTB25454 20756937 C to G
FTB25455 20761435 A to G
FTB25456 20761595 C to T
FTB25457 20763951 C to G
FTB25458 20768483 T to C
FTB25459 20768505 A to T
FTB25460 20768506 T to A
FTB25461 20768544 A to G
FTB25462 20769149 G to A
FTB25463 20781229 C to T
FTB25464 20784113 A to G
FTB25465 20791308 A to T
FTB25466 20795901 A to T
FTB25467 20796977 A to G
FTB25468 20809327 C to T
FTB25469 20812698 C to A
FTB25470 20815449 G to A
FTB25471 20860374 A to G
FTB25472 20862482 G to A
FTB25473 20869974 T to C
FTB25474 20878531 G to T
FTB25475 20878629 C to T
FTB25476 20906030 C to A
FTB25477 20906156 T to A
FTB25478 20911444 C to A
FTB25479 20912077 C to A
FTB25480 20913188 G to C
FTB25481 20913600 G to A
FTB25482 20950730 C to T
FTB25483 20950842 C to A
FTB25484 20951067 G to C
FTB25485 20952431 C to G
FTB25486 20952458 T to C
FTB25487 20952511 C to A
FTB25488 20953655 C to T
FTB25489 20954499 C to A
FTB25490 20955583 T to A
FTB25491 20956932 A to C
FTB25492 20960648 G to T
FTB25493 20962213 G to A
FTB25494 20986179 A to G
FTB25495 20986227 G to A
FTB25496 20986486 G to A
FTB25497 20990532 T to G
FTB25498 20991501 G to T
FTB25499 20991502 A to T
FTB25500 20993920 A to G
FTB25501 20993931 A to G
FTB25502 20994794 T to C
FTB25503 20999448 G to A
FTB25504 20999765 G to T
FTB25505 20999945 C to G
FTB25506 21001743 G to A
FTB25507 21004027 C to T
FTB25508 21004239 C to G
FTB25509 21047203 A to T
FTB25510 21073489 C to G
FTB25511 21076474 T to C
FTB25512 21082831 T to C
FTB25513 21087341 C to T
FTB25514 21088190 C to A
FTB25515 21090112 A to G
FTB25516 21096346 A to C
FTB25517 21106561 C to A
FTB25518 21135613 C to A
FTB25519 21141804 T to C
FTB25520 21141805 C to T
FTB25521 21141860 T to C
FTB25522 21166876 A to G
FTB25523 21243526 A to G
FTB25524 21245474 C to T
FTB25525 21245508 A to G
FTB25526 21246887 C to G
FTB25527 21247493 C to T
FTB25528 21260438 G to A
FTB25529 21267047 A to G
FTB25530 21267508 T to A
FTB25531 21296645 A to G
FTB25532 21307352 T to C
FTB25533 21311273 G to A
FTB25534 21324364 G to C
FTB25535 21327483 A to G
FTB25536 21329720 T to G
FTB25537 21329903 T to C
FTB25538 21330362 A to G
FTB25539 21334253 T to C
FTB25540 21339948 G to T
FTB25541 21342416 C to T
FTB25542 21342875 A to G
FTB25543 21343768 T to C
FTB25544 21344007 T to C
FTB25545 21344190 G to A
FTB25546 21346248 G to A
FTB25547 21353344 C to T
FTB25548 21353740 A to T
FTB25549 21362818 G to A
FTB25550 21373840 C to T
FTB25551 21382354 A to G
FTB25552 21382577 A to C
FTB25553 21384399 A to C
FTB25554 21384913 G to A
FTB25555 21385070 T to C
FTB25556 21385579 C to T
FTB25557 21385849 C to A
FTB25558 21386412 C to A
FTB25559 21389876 G to T
FTB25560 21394985 C to T
FTB25561 21395874 T to C
FTB25562 21397404 T to G
FTB25563 21400508 A to G
FTB25564 21404595 C to A
FTB25565 21406807 G to A
FTB25566 21409441 G to C
FTB25567 21418519 T to C
FTB25568 21419562 T to A
FTB25569 21420214 G to C
FTB25570 21423803 G to A
FTB25571 21424143 C to T
FTB25572 21427491 G to C
FTB25573 21434640 C to G
FTB25574 21443655 T to A
FTB25575 21444502 T to G
FTB25576 21445698 C to T
FTB25577 21446074 C to A
FTB25578 21446099 G to C
FTB25579 21446100 A to T
FTB25580 21449267 G to A
FTB25581 21450212 G to A
FTB25582 21454640 C to T
FTB25583 21455072 A to G
FTB25584 21459319 T to A
FTB25585 21463979 G to A
FTB25586 21465165 G to T
FTB25587 21465346 T to C
FTB25588 21466214 G to T
FTB25589 21469528 A to T
FTB25590 21472542 T to C
FTB25591 21473327 C to T
FTB25592 21586165 C to G
FTB25593 21590459 T to C
FTB25594 21593243 A to C
FTB25595 21598611 G to A
FTB25596 21599389 G to A
FTB25597 21600193 C to T
FTB25598 21602518 C to A
FTB25599 21604114 A to C
FTB25600 21610001 T to G
FTB25601 21620518 G to T
FTB25602 21620926 T to C
FTB25603 21632195 T to C
FTB25604 21632881 T to C
FTB25605 21635723 C to A
FTB25606 21637280 C to T
FTB25607 21637414 A to T
FTB25608 21638570 A to G
FTB25609 21644040 T to A
FTB25610 21670507 T to C
FTB25611 21673133 G to C
FTB25612 21677398 C to T
FTB25613 21690493 G to T
FTB25614 21697131 G to C
FTB25615 21698332 G to T
FTB25616 21700008 G to A
FTB25617 21701773 T to C
FTB25618 21703412 G to A
FTB25619 21710037 A to G
FTB25620 21710824 C to A
FTB25621 21710832 C to A
FTB25622 21711408 T to C
FTB25623 21711919 A to C
FTB25624 21712396 A to G
FTB25625 21812845 C to T
FTB25626 21816489 G to A
FTB25627 21818618 G to A
FTB25628 21821689 C to G
FTB25629 21822587 G to A
FTB25630 21823868 T to C
FTB25631 21823957 G to A
FTB25632 21834973 C to T
FTB25633 21837722 A to G
FTB25634 21838704 C to T
FTB25635 21839958 G to A
FTB25636 21840543 T to C
FTB25637 21840842 C to T
FTB25638 21841550 C to G
FTB25639 21841979 C to T
FTB25640 21842575 T to C
FTB25641 21844391 C to G
FTB25642 21844864 T to C
FTB25643 22234016 T to C
FTB25644 22234148 T to C
FTB25645 22234662 C to G
FTB25646 22244479 A to C
FTB25647 22254306 T to C
FTB25648 22263496 T to G
FTB25649 22263654 T to G
FTB25650 22263823 T to C
FTB25651 22268491 C to T
FTB25652 22271686 A to C
FTB25653 22273333 C to T
FTB25654 22284504 G to A
FTB25655 22284714 C to T
FTB25656 22296819 A to G
FTB25657 22297937 G to T
FTB25658 22298746 G to A
FTB25659 22307152 C to T
FTB25660 22307239 G to A
FTB25661 22307415 C to A
FTB25662 22307788 G to A
FTB25663 22316953 C to A
FTB25664 22316980 A to C
FTB25665 22317702 A to G
FTB25666 22318295 A to C
FTB25667 22326602 T to C
FTB25668 22330960 T to C
FTB25669 22331793 G to A
FTB25670 22332188 C to T
FTB25671 26316919 G to A
FTB25672 26352295 C to T
FTB25673 26383713 A to G
FTB25674 26414170 G to C
FTB25675 26419071 T to C
FTB25676 26419286 G to T
FTB25677 26480033 C to A
FTB25678 26480637 G to C
FTB25679 26485580 G to C
FTB25680 26542913 T to A
FTB25681 26543945 A to C
FTB25682 26601109 T to C
FTB25683 2790282 C to T
FTB25684 2793202 G to T
FTB25685 2793687 G to A
FTB25686 2794928 C to G
FTB25687 2842602 C to T
FTB25688 2846492 G to A
FTB25689 2848005 T to A
FTB25690 2848660 A to G
FTB25691 2855437 T to C
FTB25692 2856042 G to C
FTB25693 2856043 C to T
FTB25694 2864508 C to T
FTB25695 2865244 A to G
FTB25696 2865481 G to C
FTB25697 2866685 T to C
FTB25698 2879008 T to C
FTB25699 2879381 T to G
FTB25700 2882935 A to G
FTB25701 2883322 G to C
FTB25702 2883844 A to G
FTB25703 2896310 A to G
FTB25704 2897106 A to G
FTB25705 2911583 A to C
FTB25706 2939844 G to A
FTB25707 2940026 T to C
FTB25708 2947629 A to G
FTB25709 2958374 G to C
FTB25710 2960052 G to T
FTB25711 2962355 A to C
FTB25712 2969452 C to T
FTB25713 2975333 C to T
FTB25714 2978700 A to G
FTB25715 2979275 T to C
FTB25716 2979306 A to G
FTB25717 2979410 T to G
FTB25718 2979972 T to C
FTB25719 2980439 G to C
FTB25720 2980708 C to A
FTB25721 2981577 G to A
FTB25722 3005880 A to G
FTB25723 3019130 T to C
FTB25724 6788155 G to A
FTB25725 6788486 G to A
FTB25726 6828420 G to T
FTB25727 6828435 C to T
FTB25728 6837036 G to A
FTB25729 6838097 G to C
FTB25730 6848325 G to T
FTB25731 6867545 T to G
FTB25732 6878200 T to G
FTB25733 6908671 C to A
FTB25734 6908741 C to G
FTB25735 6909046 C to A
FTB25736 6909954 T to C
FTB25737 6910032 T to C
FTB25738 6915741 C to T
FTB25739 6916072 T to C
FTB25740 6916133 C to T
FTB25741 6918130 T to C
FTB25742 6920595 C to G
FTB25743 6920731 T to C
FTB25744 6920772 A to G
FTB25745 6934498 T to C
FTB25746 6936011 C to T
FTB25747 6972032 G to T
FTB25748 6974576 T to G
FTB25749 6977022 C to T
FTB25750 6993863 C to T
FTB25751 6994618 G to A
FTB25752 6994883 G to C
FTB25753 6998639 C to G
FTB25754 7000066 G to A
FTB25755 7000108 G to A
FTB25756 7000322 C to G
FTB25757 7003373 T to C
FTB25758 7003763 A to G
FTB25759 7017607 A to G
FTB25760 7018001 A to C
FTB25761 7022129 T to C
FTB25762 7025859 T to C
FTB25763 7028169 G to A
FTB25764 7036093 T to C
FTB25765 7036573 G to A
FTB25766 7037075 C to T
FTB25767 7039740 G to A
FTB25768 7040631 A to G
FTB25769 7041881 G to A
FTB25770 7063828 A to G
FTB25771 7070228 G to T
FTB25772 7073688 A to G
FTB25773 7073701 C to T
FTB25774 7074251 T to A
FTB25775 7075421 C to G
FTB25776 7079403 C to T
FTB25777 7082868 C to A
FTB25778 7085714 T to C
FTB25779 7085751 G to A
FTB25780 7086220 G to A
FTB25781 7087330 C to A
FTB25782 7087799 T to C
FTB25783 7087961 T to G
FTB25784 7088457 A to T
FTB25785 7092853 G to A
FTB25786 7094072 C to T
FTB25787 7101279 C to T
FTB25788 7101678 C to G
FTB25789 7102648 T to C
FTB25790 7106469 G to T
FTB25791 7106604 T to C
FTB25792 7121547 C to A
FTB25793 7127312 A to C
FTB25794 7175489 C to G
FTB25795 7189952 C to G
FTB25796 7197701 G to T
FTB25797 7197854 A to C
FTB25798 7199807 A to G
FTB25799 7305580 G to C
FTB25800 7310598 G to A
FTB25801 7357180 C to A
FTB25802 7377218 C to T
FTB25803 7377239 T to C
FTB25804 7378587 A to G
FTB25805 7379260 C to T
FTB25806 7383573 C to T
FTB25807 7383747 A to T
FTB25808 7383788 A to C
FTB25809 7384727 G to A
FTB25810 7393495 T to C
FTB25811 7394113 T to C
FTB25812 7394894 T to A
FTB25813 7395219 C to T
FTB25814 7397651 G to A
FTB25815 7398126 T to C
FTB25816 7398233 C to G
FTB25817 7400392 A to G
FTB25818 7411299 T to C
FTB25819 7412338 T to C
FTB25820 7415322 G to A
FTB25821 7416414 C to A
FTB25822 7418928 G to A
FTB25823 7422485 A to G
FTB25824 7423292 A to C
FTB25825 7424974 C to T
FTB25826 7425299 A to G
FTB25827 7440977 C to T
FTB25828 7447010 A to G
FTB25829 7449408 T to G
FTB25830 7455643 G to T
FTB25831 7458599 C to T
FTB25832 7462639 A to G
FTB25833 7463101 C to T
FTB25834 7465552 T to G
FTB25835 7465594 C to A
FTB25836 7467286 C to A
FTB25837 7482042 C to T
FTB25838 7496574 A to G
FTB25839 7496981 A to G
FTB25840 7518696 C to T
FTB25841 7529768 T to A
FTB25842 7537140 C to T
FTB25843 7540242 T to A
FTB25844 7578559 C to T
FTB25845 7589956 A to T
FTB25846 7594353 G to A
FTB25847 7600716 A to G
FTB25848 7631377 G to T
FTB25849 7635659 A to G
FTB25850 7638071 G to A
FTB25851 7642998 T to A
FTB25852 7656308 T to C
FTB25853 7659175 G to A
FTB25854 7659271 A to G
FTB25855 7659905 G to C
FTB25856 7660644 G to A
FTB25857 7662223 A to G
FTB25858 7665450 T to G
FTB25859 7678446 C to T
FTB25860 7681374 T to C
FTB25861 7681699 T to C
FTB25862 7686619 A to G
FTB25863 7689118 C to T
FTB25864 7691249 C to G
FTB25865 7691450 C to A
FTB25866 7692930 G to A
FTB25867 7695633 A to G
FTB25868 7697948 A to G
FTB25869 7700482 C to A
FTB25870 7701808 C to T
FTB25871 7702504 G to A
FTB25872 7703011 G to T
FTB25873 7703757 C to T
FTB25874 7716136 A to G
FTB25875 7716817 T to C
FTB25876 7717165 C to T
FTB25877 7717894 T to A
FTB25878 7721429 C to T
FTB25879 7723980 A to G
FTB25880 7724096 T to C
FTB25881 7724546 C to T
FTB25882 7725495 G to C
FTB25883 7726686 G to C
FTB25884 7727500 T to C
FTB25885 7729010 T to G
FTB25886 7729720 T to C
FTB25887 7730813 G to A
FTB25888 7733798 C to G
FTB25889 7737256 G to A
FTB25890 7738050 G to C
FTB25891 7739766 A to G
FTB25892 7743945 C to T
FTB25893 7744362 T to G
FTB25894 7751240 C to T
FTB25895 7751540 T to C
FTB25896 7752182 C to T
FTB25897 7754830 T to C
FTB25898 7756025 G to A
FTB25899 7759300 G to T
FTB25900 7759407 T to C
FTB25901 7760689 A to T
FTB25902 7769284 C to T
FTB25903 7770034 C to G
FTB25904 7770732 T to C
FTB25905 7775859 T to C
FTB25906 7776257 A to G
FTB25907 7792641 C to T
FTB25908 7803970 C to G
FTB25909 7808756 C to A
FTB25910 7809060 T to C
FTB25911 7815142 T to A
FTB25912 7828610 C to T
FTB25913 7828748 A to C
FTB25914 7848321 C to A
FTB25915 7851409 G to T
FTB25916 7861454 T to A
FTB25917 7891754 G to C
FTB25918 7891838 G to C
FTB25919 7902127 G to T
FTB25920 7904116 G to C
FTB25921 7904237 C to T
FTB25922 7933087 G to A
FTB25923 7933933 G to A
FTB25924 7934291 T to C
FTB25925 7951812 A to T
FTB25926 7958484 G to A
FTB25927 7958900 G to A
FTB25928 8015131 A to T
FTB25929 8111944 C to T
FTB25930 8112263 G to A
FTB25931 8129331 G to C
FTB25932 8129987 A to C
FTB25933 8130063 G to T
FTB25934 8130764 A to T
FTB25935 8134166 A to C
FTB25936 8147458 T to A
FTB25937 8150307 G to A
FTB25938 8151743 G to T
FTB25939 8153999 A to G
FTB25940 8154013 A to C
FTB25941 8154991 C to T
FTB25942 8155563 T to C
FTB25943 8156050 T to C
FTB25944 8156647 G to C
FTB25945 8158280 T to C
FTB25946 8170755 A to G
FTB25947 8171191 C to G
FTB25948 8182608 T to A
FTB25949 8191266 C to T
FTB25950 8191778 A to G
FTB25951 8193109 A to G
FTB25952 8193304 T to C
FTB25953 8200630 T to C
FTB25954 8220988 G to T
FTB25955 8221103 A to G
FTB25956 8233173 A to G
FTB25957 8235653 A to G
FTB25958 8251784 A to C
FTB25959 8252729 C to A
FTB25960 8253059 G to A
FTB25961 8253231 G to A
FTB25962 8254497 G to A
FTB25963 8259272 G to A
FTB25964 8263795 A to G
FTB25965 8264056 G to T
FTB25966 8265158 C to A
FTB25967 8271279 T to C
FTB25968 8278404 C to T
FTB25969 8279585 G to A
FTB25970 8280337 A to C
FTB25971 8281539 G to A
FTB25972 8282039 T to C
FTB25973 8284287 T to C
FTB25974 8341568 G to C
FTB25975 8370144 G to A
FTB25976 8371531 G to C
FTB25977 8373169 T to C
FTB25978 8373365 A to G
FTB25979 8407473 G to A
FTB25980 8413252 G to A
FTB25981 8413893 T to G
FTB25982 8426132 T to A
FTB25983 8431010 A to G
FTB25984 8467056 C to T
FTB25985 8479251 G to A
FTB25986 8479290 T to C
FTB25987 8479431 T to A
FTB25988 8479905 C to T
FTB25989 8484201 G to A
FTB25990 8496215 A to G
FTB25991 8499244 T to A
FTB25992 8499588 A to C
FTB25993 8500051 T to A
FTB25994 8500052 T to A
FTB25995 8500220 C to G
FTB25996 8501180 A to G
FTB25997 8512524 T to C
FTB25998 8515967 T to A
FTB25999 8517081 T to C
FTB26000 8525828 G to A
FTB26001 8529508 T to C
FTB26002 8530590 A to G
FTB26003 8535683 C to A
FTB26004 8548349 A to T
FTB26005 8548525 C to G
FTB26006 8550312 A to G
FTB26007 8552639 C to G
FTB26008 8552879 T to C
FTB26009 8553101 C to T
FTB26010 8553115 C to A
FTB26011 8553503 C to T
FTB26012 8555446 C to T
FTB26013 8557139 T to G
FTB26014 8557490 C to T
FTB26015 8558025 A to G
FTB26016 8558127 A to G
FTB26017 8559454 C to A
FTB26018 8563594 G to A
FTB26019 8566475 G to T
FTB26020 8568358 G to C
FTB26021 8570300 T to A
FTB26022 8570433 C to A
FTB26023 8570984 A to G
FTB26024 8575687 A to C
FTB26025 8582539 T to C
FTB26026 8585061 G to T
FTB26027 8585149 T to C
FTB26028 8590043 C to T
FTB26029 8590472 C to T
FTB26030 8592365 G to T
FTB26031 8592484 A to T
FTB26032 8594410 A to G
FTB26033 8595209 A to G
FTB26034 8598588 T to G
FTB26035 8599321 A to T
FTB26036 8599476 G to C
FTB26037 8599539 T to C
FTB26038 8601145 G to A
FTB26039 8602717 G to T
FTB26040 8609065 G to A
FTB26041 8609423 G to C
FTB26042 8611157 T to C
FTB26043 8615045 G to C
FTB26044 8616971 A to G
FTB26045 8617064 A to G
FTB26046 8617797 T to A
FTB26047 8620565 G to A
FTB26048 8621407 G to T
FTB26049 8621728 G to A
FTB26050 8623991 C to T
FTB26051 8630382 T to C
FTB26052 8630388 C to T
FTB26053 8632666 A to C
FTB26054 8635210 T to C
FTB26055 8637234 G to C
FTB26056 8641689 G to T
FTB26057 8641827 T to G
FTB26058 8642114 C to T
FTB26059 8642142 A to G
FTB26060 8644672 T to C
FTB26061 8650258 T to C
FTB26062 8655537 A to T
FTB26063 8659925 C to T
FTB26064 8661551 T to C
FTB26065 8665981 C to G
FTB26066 8666336 C to A
FTB26067 8667585 G to T
FTB26068 8668012 C to T
FTB26069 8668822 C to T
FTB26070 8676661 G to A
FTB26071 8677045 C to T
FTB26072 8679233 A to G
FTB26073 8680057 C to T
FTB26074 8680345 C to T
FTB26075 8684288 C to T
FTB26076 8684406 T to C
FTB26077 8685663 G to A
FTB26078 8686407 G to A
FTB26079 8687099 G to A
FTB26080 8688914 C to A
FTB26081 8691059 T to C
FTB26082 8691303 A to G
FTB26083 8693030 G to A
FTB26084 8697702 A to G
FTB26085 8698702 C to G
FTB26086 8700110 T to A
FTB26087 8701723 A to G
FTB26088 8701728 C to T
FTB26089 8711734 C to T
FTB26090 8712803 G to A
FTB26091 8715168 C to A
FTB26092 8715480 G to T
FTB26093 8717505 C to A
FTB26094 8718140 A to C
FTB26095 8722374 G to A
FTB26096 8724967 G to A
FTB26097 8727860 G to A
FTB26098 8728404 G to A
FTB26099 8730874 T to C
FTB26100 8732799 A to G
FTB26101 8734651 G to A
FTB26102 8734668 G to A
FTB26103 8734686 T to C
FTB26104 8734769 A to T
FTB26105 8738416 A to G
FTB26106 8740794 C to G
FTB26107 8740953 T to C
FTB26108 8745759 C to G
FTB26109 8748601 C to T
FTB26110 8749171 G to C
FTB26111 8750313 T to C
FTB26112 8752205 G to A
FTB26113 8753622 C to G
FTB26114 8759780 C to T
FTB26115 8761727 G to A
FTB26116 8764496 C to T
FTB26117 8766864 C to T
FTB26118 8767312 G to A
FTB26119 8769803 C to T
FTB26120 8770650 C to A
FTB26121 8771230 G to A
FTB26122 8771698 T to C
FTB26123 8788912 T to C
FTB26124 8789019 G to C
FTB26125 8789348 A to T
FTB26126 8798225 G to A
FTB26127 8799197 G to C
FTB26128 8812891 T to C
FTB26129 8813862 T to C
FTB26130 8814443 T to C
FTB26131 8817944 T to C
FTB26132 8820773 T to C
FTB26133 8827275 A to G
FTB26134 8832191 T to G
FTB26135 8833519 G to A
FTB26136 8841061 T to G
FTB26137 8841115 A to C
FTB26138 8841628 A to G
FTB26139 8843047 A to G
FTB26140 8849960 G to T
FTB26141 8859424 G to A
FTB26142 8859596 A to G
FTB26143 8860778 T to C
FTB26144 8869034 G to A
FTB26145 8869588 A to C
FTB26146 8870669 T to C
FTB26147 8885632 C to T
FTB26148 8886286 T to C
FTB26149 8887354 C to T
FTB26150 8890000 G to A
FTB26151 8891588 G to A
FTB26152 8895879 A to G
FTB26153 8903155 C to T
FTB26154 8904257 G to C
FTB26155 8912023 C to T
FTB26156 8912108 A to G
FTB26157 8916776 A to G
FTB26158 8925770 A to G
FTB26159 8927292 A to T
FTB26160 8930277 A to T
FTB26161 8934952 T to C
FTB26162 8935240 G to T
FTB26163 8941514 G to C
FTB26164 8942013 T to G
FTB26165 8962014 A to G
FTB26166 8962261 T to G
FTB26167 8962295 G to A
FTB26168 8965362 A to T
FTB26169 8972968 G to T
FTB26170 8974726 A to T
FTB26171 8976021 G to A
FTB26172 8977679 C to G
FTB26173 8978111 T to C
FTB26174 9003159 G to A
FTB26175 9004721 T to C
FTB26176 9004723 C to G
FTB26177 9004863 C to A
FTB26178 9005392 C to T
FTB26179 9008099 C to A
FTB26180 9013296 A to T
FTB26181 9013764 G to C
FTB26182 9018900 T to C
FTB26183 9024208 G to A
FTB26184 9026122 T to C
FTB26185 9030308 T to C
FTB26186 9030404 A to G
FTB26187 9030700 G to A
FTB26188 9031516 A to G
FTB26189 9035332 T to C
FTB26190 9129144 T to C
FTB26191 9131911 A to C
FTB26192 9133609 A to G
FTB26193 9153015 A to G
FTB26194 9153283 T to C
FTB26195 9154020 G to T
FTB26196 9155824 A to T
FTB26197 9162591 A to T
FTB26198 9187039 A to G
FTB26199 9187076 T to C
FTB26200 9199153 C to A
FTB26201 9201482 T to G
FTB26202 9221351 A to G
FTB26203 9222819 C to A
FTB26204 9227508 A to T
FTB26205 9227648 C to A
FTB26206 9234618 T to C
FTB26207 9262308 G to A
FTB26208 9270847 C to T
FTB26209 9271140 A to G
FTB26210 9290542 T to C
FTB26211 9292962 T to G
FTB26212 9293229 C to A
FTB26213 9293581 C to T
FTB26214 9293596 C to T
FTB26215 9293630 G to T
FTB26216 9295330 C to T
FTB26217 9299614 T to C
FTB26218 9301364 A to G
FTB26219 9301754 T to C
FTB26220 9305201 G to A
FTB26221 9305508 C to T
FTB26222 9306399 G to T
FTB26223 9306455 G to A
FTB26224 9308324 C to A
FTB26225 9314312 G to C
FTB26226 9317236 T to C
FTB26227 9317509 G to A
FTB26228 9317511 G to C
FTB26229 9318760 C to A
FTB26230 9324702 C to A
FTB26231 9325177 C to G
FTB26232 9326132 A to G
FTB26233 9326333 T to C
FTB26234 9326754 A to G
FTB26235 9329735 A to G
FTB26236 9329930 C to G
FTB26237 9330493 A to T
FTB26238 9333308 C to A
FTB26239 9338028 G to A
FTB26240 9340507 T to G
FTB26241 9340569 A to G
FTB26242 9340742 T to C
FTB26243 9358404 C to T
FTB26244 9361205 A to T
FTB26245 9567009 T to C
FTB26246 9567497 C to T
FTB26247 9567524 A to G
FTB26248 9584603 C to G
FTB26249 9585820 C to A
FTB26250 9599987 G to A
FTB26251 9611542 T to A
FTB26252 9612550 T to G
FTB26253 9978939 C to T
FTB26254 9981230 C to A
FTB26255 9991424 G to T
FTB26256 9997751 C to T
FTB26257 10006052 A to G
FTB26258 10006290 G to A
FTB26259 10009050 A to T
FTB26260 10009113 T to G
FTB26261 10012906 T to G
FTB26262 10013154 C to T
FTB26263 10013711 C to T
FTB26264 10017236 G to C
FTB26265 10022097 G to T
FTB26266 10025184 C to T
FTB26267 10028441 C to A
FTB26268 10029945 C to T
FTB26269 10035180 T to C
FTB26270 10059186 A to G
FTB26271 11772177 A to C
FTB26272 11772544 G to T
FTB26273 11775570 G to C
FTB26274 11775574 C to A
FTB26275 11775783 G to T
FTB26276 11882176 A to G
FTB26277 11882610 T to A
FTB26278 11882776 T to C
FTB26279 11884345 A to C
FTB26280 11896715 G to A
FTB26281 11897343 G to T
FTB26282 11903636 A to G
FTB26283 11915978 T to G
FTB26284 11924189 T to G
FTB26285 11939686 T to G
FTB26286 11944454 A to G
FTB26287 11948861 G to T
FTB26288 11949397 T to G
FTB26289 11957327 C to A
FTB26290 11957808 T to C
FTB26291 11968241 G to A
FTB26292 11968433 A to T
FTB26293 11968569 A to G
FTB26294 11969135 G to A
FTB26295 11971030 T to C
FTB26296 11971052 T to G
FTB26297 11971167 A to G
FTB26298 11972960 T to A
FTB26299 11975728 T to C
FTB26300 11976501 G to T
FTB26301 11978941 C to T
FTB26302 11985561 T to G
FTB26303 11985974 C to A
FTB26304 11987207 C to A
FTB26305 11987208 C to A
FTB26306 11987772 A to G
FTB26307 11994959 A to T
FTB26308 12006500 C to T
FTB26309 12007298 T to C
FTB26310 12015947 G to C
FTB26311 12016029 A to T
FTB26312 12016301 A to C
FTB26313 12016954 G to A
FTB26314 12017484 C to A
FTB26315 12017893 T to A
FTB26316 12018284 T to A
FTB26317 12028148 C to A
FTB26318 12029575 C to G
FTB26319 12030034 C to T
FTB26320 12031237 C to A
FTB26321 12031521 C to A
FTB26322 12053096 G to A
FTB26323 12053749 G to A
FTB26324 12067733 T to C
FTB26325 12068496 T to C
FTB26326 12076302 C to G
FTB26327 12076976 C to G
FTB26328 12076995 C to T
FTB26329 12077110 T to C
FTB26330 12085175 A to G
FTB26331 12086107 G to A
FTB26332 12086654 C to T
FTB26333 12087200 C to G
FTB26334 12088706 G to T
FTB26335 12102882 C to T
FTB26336 12105339 G to A
FTB26337 12110544 T to A
FTB26338 12110670 A to G
FTB26339 12119981 T to C
FTB26340 12121022 A to G
FTB26341 12122842 T to C
FTB26342 12127551 A to G
FTB26343 12143948 G to C
FTB26344 12143979 A to T
FTB26345 12144734 A to G
FTB26346 12145437 C to T
FTB26347 12161497 G to A
FTB26348 12167122 T to C
FTB26349 12190192 T to C
FTB26350 12190440 G to T
FTB26351 12197142 T to G
FTB26352 12197393 T to C
FTB26353 12200539 A to C
FTB26354 12200875 T to A
FTB26355 12205617 G to A
FTB26356 12205821 G to T
FTB26357 12210533 C to T
FTB26358 12211361 G to A
FTB26359 12211391 T to C
FTB26360 12211392 A to T
FTB26361 12230058 G to T
FTB26362 12232617 G to C
FTB26363 12232783 C to G
FTB26364 12274309 A to C
FTB26365 12280307 T to G
FTB26366 12280309 G to T
FTB26367 12280654 C to A
FTB26368 12283422 C to A
FTB26369 12284820 A to C
FTB26370 12286957 G to C
FTB26371 12287554 G to C
FTB26372 12288136 C to G
FTB26373 12312732 G to C
FTB26374 12313694 A to G
FTB26375 12316792 A to G
FTB26376 12322426 G to T
FTB26377 12357695 C to T
FTB26378 12362157 G to T
FTB26379 12386521 G to C
FTB26380 12386588 G to A
FTB26381 12404573 T to A
FTB26382 12404873 C to A
FTB26383 12416327 A to G
FTB26384 12416437 G to A
FTB26385 12423332 G to A
FTB26386 12430946 G to A
FTB26387 12431718 T to C
FTB26388 12436620 C to A
FTB26389 12441863 T to C
FTB26390 12489201 G to A
FTB26391 12489418 A to C
FTB26392 12516941 C to T
FTB26393 12529425 T to A
FTB26394 12535776 C to T
FTB26395 12536707 G to T
FTB26396 12537929 G to C
FTB26397 12540045 G to A
FTB26398 12541594 A to G
FTB26399 12541905 A to G
FTB26400 12553310 G to A
FTB26401 12553336 G to T
FTB26402 12585497 T to C
FTB26403 12595771 A to G
FTB26404 12598568 A to G
FTB26405 12610909 A to G
FTB26406 12610917 T to C
FTB26407 12611223 A to G
FTB26408 12661357 A to C
FTB26409 12672198 G to A
FTB26410 12672509 T to C
FTB26411 12718062 T to A
FTB26412 12734408 T to G
FTB26413 12738068 A to G
FTB26414 12738173 A to G
FTB26415 12741761 T to C
FTB26416 12748463 T to A
FTB26417 12748844 G to T
FTB26418 12760171 G to T
FTB26419 12761790 T to C
FTB26420 12763002 T to C
FTB26421 12763343 G to C
FTB26422 12763444 G to A
FTB26423 12769447 T to C
FTB26424 12770872 C to T
FTB26425 12771039 T to C
FTB26426 12771082 G to A
FTB26427 12773769 A to T
FTB26428 12773823 A to G
FTB26429 12777142 G to C
FTB26430 12778400 T to C
FTB26431 12778401 A to G
FTB26432 12778593 C to T
FTB26433 12779365 T to A
FTB26434 12787009 C to G
FTB26435 12803210 G to T
FTB26436 12809924 A to C
FTB26437 12810050 T to C
FTB26438 12810071 G to A
FTB26439 12810346 A to G
FTB26440 12811314 G to A
FTB26441 12840648 A to G
FTB26442 12842547 T to A
FTB26443 12856895 G to C
FTB26444 12859582 T to C
FTB26445 12864640 C to A
FTB26446 12905899 A to G
FTB26447 12912087 A to G
FTB26448 12912801 G to A
FTB26449 12913004 A to G
FTB26450 12918643 T to A
FTB26451 12919541 C to T
FTB26452 12921412 C to T
FTB26453 12930275 T to G
FTB26454 12930332 A to G
FTB26455 12935159 C to A
FTB26456 12942585 C to G
FTB26457 12942589 T to G
FTB26458 12954926 C to T
FTB26459 12955208 T to A
FTB26460 12959509 C to A
FTB26461 12960229 T to C
FTB26462 12960331 T to C
FTB26463 12960488 A to T
FTB26464 12973900 T to C
FTB26465 12984978 C to A
FTB26466 12984988 T to A
FTB26467 12985122 G to A
FTB26468 13082190 C to G
FTB26469 13112177 T to A
FTB26470 13129595 T to C
FTB26471 13162874 A to G
FTB26472 13162876 C to A
FTB26473 13204554 C to T
FTB26474 13206877 G to A
FTB26475 13238510 A to G
FTB26476 13238549 C to T
FTB26477 13245345 C to T
FTB26478 13247981 A to G
FTB26479 13248632 A to G
FTB26480 13249615 G to A
FTB26481 13250448 A to G
FTB26482 13261326 C to T
FTB26483 13262344 A to C
FTB26484 13263322 T to C
FTB26485 13272994 A to G
FTB26486 13273136 G to T
FTB26487 13275408 T to C
FTB26488 13305980 T to C
FTB26489 13328813 T to C
FTB26490 13343503 A to G
FTB26491 13343701 C to T
FTB26492 13343896 A to G
FTB26493 13344340 C to T
FTB26494 13344799 C to G
FTB26495 13345873 T to C
FTB26496 13346393 G to A
FTB26497 13361112 G to A
FTB26498 13363615 A to G
FTB26499 13366349 T to C
FTB26500 13375552 T to C
FTB26501 13376852 A to G
FTB26502 13376866 A to G
FTB26503 13379674 C to T
FTB26504 13394215 T to G
FTB26505 13394824 A to G
FTB26506 13397773 A to C
FTB26507 13397869 A to T
FTB26508 13406072 A to G
FTB26509 13407348 A to C
FTB26510 13408182 T to C
FTB26511 13412609 A to T
FTB26512 13413737 G to A
FTB26513 13414000 T to C
FTB26514 13414955 A to G
FTB26515 13423322 C to T
FTB26516 13432660 C to T
FTB26517 13436527 G to T
FTB26518 13438557 C to G
FTB26519 13440057 C to T
FTB26520 13441788 T to C
FTB26521 13456004 C to T
FTB26522 13459342 C to T
FTB26523 13464397 C to T
FTB26524 13475201 A to C
FTB26525 13475256 C to G
FTB26526 13480070 G to A
FTB26527 13498341 T to C
FTB26528 13501894 C to T
FTB26529 13513130 C to G
FTB26530 13513173 C to G
FTB26531 13513233 C to T
FTB26532 13522536 C to A
FTB26533 13522679 T to G
FTB26534 13522696 A to T
FTB26535 13523174 A to G
FTB26536 13523612 T to A
FTB26537 13552664 C to G
FTB26538 13552985 T to C
FTB26539 13553044 C to T
FTB26540 13555734 T to A
FTB26541 13591917 C to T
FTB26542 13593008 C to T
FTB26543 13593466 A to G
FTB26544 13594024 T to C
FTB26545 13626206 C to T
FTB26546 13637922 G to C
FTB26547 13638047 T to C
FTB26548 13638323 T to G
FTB26549 13638338 T to C
FTB26550 13639262 T to G
FTB26551 13640370 A to T
FTB26552 13653780 A to G
FTB26553 13653940 T to A
FTB26554 13654175 T to C
FTB26555 13672023 T to A
FTB26556 13698548 A to G
FTB26557 13700716 C to T
FTB26558 13700815 T to A
FTB26559 13703051 A to G
FTB26560 13717559 A to G
FTB26561 13718492 G to T
FTB26562 13719351 C to A
FTB26563 13729038 T to A
FTB26564 13735805 T to C
FTB26565 13739841 C to A
FTB26566 13740060 A to C
FTB26567 13740391 C to A
FTB26568 13749523 T to C
FTB26569 13750693 T to G
FTB26570 13755161 A to C
FTB26571 13755321 A to C
FTB26572 13755349 G to C
FTB26573 13756153 C to A
FTB26574 13760584 G to A
FTB26575 13766995 G to C
FTB26576 13769637 C to T
FTB26577 13786111 C to T
FTB26578 13786256 G to C
FTB26579 13788876 A to G
FTB26580 13789250 T to G
FTB26581 13792508 T to C
FTB26582 13801427 T to G
FTB26583 13801863 A to G
FTB26584 13817247 A to G
FTB26585 13821226 A to G
FTB26586 13837391 C to G
FTB26587 13854847 C to T
FTB26588 13861069 T to C
FTB26589 13864251 T to C
FTB26590 13867145 A to T
FTB26591 13868078 T to G
FTB26592 13868346 A to C
FTB26593 13869476 A to T
FTB26594 13871842 A to G
FTB26595 13873287 A to G
FTB26596 13884477 A to G
FTB26597 13884482 A to T
FTB26598 13884815 C to T
FTB26599 13894918 A to C
FTB26600 13905845 G to A
FTB26601 13905902 C to T
FTB26602 13908018 T to A
FTB26603 13928375 T to C
FTB26604 13930725 C to T
FTB26605 13931030 C to A
FTB26606 13931208 T to C
FTB26607 13936935 G to T
FTB26608 13937420 G to C
FTB26609 14058802 C to T
FTB26610 14059198 C to G
FTB26611 14060739 C to T
FTB26612 14062949 G to T
FTB26613 14066220 T to C
FTB26614 14072244 T to C
FTB26615 14073742 C to T
FTB26616 14087283 C to T
FTB26617 14087711 A to T
FTB26618 14090652 G to A
FTB26619 14091611 T to A
FTB26620 14092336 G to T
FTB26621 14093157 T to C
FTB26622 14115183 C to G
FTB26623 14118544 T to C
FTB26624 14135373 C to G
FTB26625 14137576 T to C
FTB26626 14137713 A to C
FTB26627 14137986 C to T
FTB26628 14138108 G to A
FTB26629 14140011 C to T
FTB26630 14140281 A to G
FTB26631 14141130 T to G
FTB26632 14141347 G to T
FTB26633 14142763 G to A
FTB26634 14143033 T to A
FTB26635 14144141 G to T
FTB26636 14145937 C to T
FTB26637 14146549 A to G
FTB26638 14151832 C to T
FTB26639 14151969 C to T
FTB26640 14168210 A to G
FTB26641 14171863 A to C
FTB26642 14175087 C to G
FTB26643 14187745 C to T
FTB26644 14201627 A to T
FTB26645 14203124 G to C
FTB26646 14212994 C to T
FTB26647 14218389 A to C
FTB26648 14218718 C to T
FTB26649 14219928 C to G
FTB26650 14219948 C to G
FTB26651 14220279 C to T
FTB26652 14234083 T to C
FTB26653 14236396 G to A
FTB26654 14249121 C to T
FTB26655 14259672 T to C
FTB26656 14262746 T to C
FTB26657 14263675 C to T
FTB26658 14265281 A to G
FTB26659 14265807 C to T
FTB26660 14266593 T to C
FTB26661 14276611 C to T
FTB26662 14278136 T to C
FTB26663 14280608 A to T
FTB26664 14296377 A to C
FTB26665 14296844 T to C
FTB26666 14297923 A to T
FTB26667 14304443 C to A
FTB26668 14304465 T to A
FTB26669 14304640 T to C
FTB26670 14321716 T to C
FTB26671 14326448 G to T
FTB26672 14337157 G to A
FTB26673 14338097 G to A
FTB26674 14341666 C to T
FTB26675 14360620 G to T
FTB26676 14365317 G to A
FTB26677 14366155 C to A
FTB26678 14366653 C to G
FTB26679 14371138 T to C
FTB26680 14373149 T to A
FTB26681 14380091 T to G
FTB26682 14380196 A to G
FTB26683 14380456 C to T
FTB26684 14392096 A to G
FTB26685 14398770 C to T
FTB26686 14401826 C to G
FTB26687 14402038 G to A
FTB26688 14406039 C to T
FTB26689 14406437 C to T
FTB26690 14411849 G to A
FTB26691 14423903 T to C
FTB26692 14424243 T to A
FTB26693 14426445 T to C
FTB26694 14444859 G to A
FTB26695 14446070 A to G
FTB26696 14446110 A to G
FTB26697 14455948 T to C
FTB26698 14480368 T to G
FTB26699 14483327 G to A
FTB26700 14483340 A to G
FTB26701 14485224 C to A
FTB26702 14491983 G to A
FTB26703 14514281 G to A
FTB26704 14549300 T to A
FTB26705 14550095 A to G
FTB26706 14554625 T to A
FTB26707 14570046 C to G
FTB26708 14583568 A to G
FTB26709 14587392 C to G
FTB26710 14587848 G to A
FTB26711 14602691 T to G
FTB26712 14603567 T to A
FTB26713 14606498 C to G
FTB26714 14606695 T to C
FTB26715 14622386 G to A
FTB26716 14624547 G to A
FTB26717 14629178 G to T
FTB26718 14629740 A to C
FTB26719 14632812 T to C
FTB26720 14639382 C to T
FTB26721 14640031 A to T
FTB26722 14640769 G to A
FTB26723 14643171 A to C
FTB26724 14643181 T to G
FTB26725 14643331 A to T
FTB26726 14647798 A to G
FTB26727 14650604 A to G
FTB26728 14651294 T to C
FTB26729 14654863 A to T
FTB26730 14659173 G to A
FTB26731 14659252 A to G
FTB26732 14676924 A to G
FTB26733 14679742 G to A
FTB26734 14680211 C to A
FTB26735 14682606 G to A
FTB26736 14685307 C to T
FTB26737 14689416 G to A
FTB26738 14706205 T to C
FTB26739 14706271 T to C
FTB26740 14707644 A to G
FTB26741 14708474 G to A
FTB26742 14712169 A to G
FTB26743 14719150 T to A
FTB26744 14723420 T to G
FTB26745 14740613 C to A
FTB26746 14740698 A to C
FTB26747 14744424 C to T
FTB26748 14745543 T to G
FTB26749 14749108 T to A
FTB26750 14749700 T to A
FTB26751 14760107 G to C
FTB26752 14763210 A to G
FTB26753 14783129 T to A
FTB26754 14783756 A to G
FTB26755 14791981 G to A
FTB26756 14806839 A to G
FTB26757 14807787 C to T
FTB26758 14808416 T to G
FTB26759 14808576 G to T
FTB26760 14808728 G to C
FTB26761 14808979 G to A
FTB26762 14810789 C to T
FTB26763 14811220 T to A
FTB26764 14815526 G to A
FTB26765 14822937 C to T
FTB26766 14824460 G to A
FTB26767 14836842 A to G
FTB26768 14836885 G to A
FTB26769 14839734 T to C
FTB26770 14849289 A to C
FTB26771 14850031 C to A
FTB26772 14879706 T to C
FTB26773 14879995 G to A
FTB26774 14880227 A to G
FTB26775 14880432 G to A
FTB26776 14880630 T to C
FTB26777 14897134 A to T
FTB26778 14900344 C to A
FTB26779 14906932 A to G
FTB26780 14929322 G to C
FTB26781 14965452 C to A
FTB26782 14966447 C to T
FTB26783 14966465 A to G
FTB26784 14967720 C to T
FTB26785 14967869 A to G
FTB26786 14998659 T to G
FTB26787 14999824 C to T
FTB26788 15004005 A to G
FTB26789 15005307 C to A
FTB26790 15025512 C to T
FTB26791 15026458 C to T
FTB26792 15035978 T to C
FTB26793 15036713 A to C
FTB26794 15036769 C to T
FTB26795 15055158 A to C
FTB26796 15060985 C to A
FTB26797 15061429 C to G
FTB26798 15062155 G to A
FTB26799 15073546 A to G
FTB26800 15074599 A to G
FTB26801 15079198 T to G
FTB26802 15086833 T to C
FTB26803 15086914 C to T
FTB26804 15087222 T to C
FTB26805 15089121 C to G
FTB26806 15090730 G to A
FTB26807 7945171 T to C
FTB26808 22352471 A to G
FTB26809 6557213 T to G
FTB26810 11043653 G to A
FTB26811 21580093 T to C
FTB26812 9808965 G to A
FTB26813 21599840 A to T
FTB26814 8606546 T to A
FTB26815 17953385 A to T
FTB26816 3312401 A to G
FTB26817 3659063 G to A
FTB26818 21861010 A to G
FTB26819 11046940 C to A
FTB26820 21442853 A to T
FTB26821 18974966 C to T
FTB26822 19767131 C to T
FTB26823 9927310 A to G
FTB26824 3293936 C to T
FTB26825 2786440 C to T
FTB26826 8715028 G to A
FTB26827 7416921 C to G
FTB26828 8599075 G to C
FTB26829 9953265 T to C
FTB26830 9553999 G to A
FTB26831 19164795 C to A
FTB26832 21582090 C to G
FTB26833 11045051 C to T
FTB26834 11043626 A to G
FTB26835 21486076 G to A
FTB26836 21486077 C to A
FTB26837 9662970 G to T
FTB26838 19706045 A to G
FTB26839 12321688 C to T
FTB26840 8564938 G to A
FTB26841 14999150 C to T
FTB26842 21567639 C to T
FTB26843 7650190 G to A
FTB26844 6320873 G to A
FTB26845 12586113 T to C
FTB26846 8562844 C to A
FTB26847 15322440 T to A
FTB26848 20554458 C to A
FTB26849 26635691 A to T
FTB26850 11776220 T to C
FTB26851 11074433 G to T
FTB26852 10806632 A to C
FTB26853 21582297 A to G
FTB26854 9545336 A to G
FTB26855 4812662 A to T
FTB26856 4841097 T to A
FTB26857 11749633 T to A
FTB26858 3796672 G to T
FTB26859 6609700 A to G
FTB26860 10981805 A to T
FTB26861 9954715 G to C
FTB26862 11654907 G to T
FTB26863 20118972 C to A
FTB26864 8646814 C to A
FTB26865 9628441 A to T
FTB26866 13974692 C to G
FTB26867 21608920 G to T
FTB26868 21000986 G to T
FTB26869 9183124 G to A
FTB26870 11076434 G to C
FTB26871 6032510 G to C
FTB26872 8900959 C to T
FTB26873 16934119 A to T
FTB26874 13608986 T to C
FTB26875 7078125 T to G
FTB26876 9907475 G to T
FTB26877 9680427 G to T
FTB26878 10913544 T to C
FTB26879 3294090 A to C
FTB26880 11081834 A to G
FTB26881 22361524 A to G
FTB26882 26626047 G to A
FTB26883 9006472 T to A
FTB26884 7035990 C to T
FTB26885 8922374 C to A
FTB26886 21412158 A to T
FTB26887 9211516 C to G
FTB26888 7519222 A to G
FTB26889 22314236 T to G
FTB26890 16589577 C to T
FTB26891 12722358 T to C
FTB26892 8187076 A to C
FTB26893 21412180 C to T
FTB26894 3279517 A to T
FTB26895 11173225 G to T
FTB26896 6179253 A to T
FTB26897 3485946 A to G
FTB26898 10084415 T to C
FTB26899 3659023 A to G
FTB26900 14094384 G to A
FTB26901 6542801 C to G
FTB26902 6096744 T to G
FTB26903 21481939 C to T
FTB26904 11658027 C to T
FTB26905 11349994 G to A
FTB26906 8761096 A to G
FTB26907 7102942 T to C
FTB26908 8192712 T to C
FTB26909 15284318 A to G
FTB26910 21568241 G to C
FTB26911 15540981 G to C
FTB26912 8344570 C to G
FTB26913 13907954 T to G
FTB26914 16057190 T to A
FTB26915 9025564 T to A
FTB26916 9025569 C to A
FTB26917 9171322 T to C
FTB26918 8974610 C to G
FTB26919 6496731 T to G
FTB26920 15596705 T to C
FTB26921 7973169 T to C
FTB26922 13928851 C to T
FTB26923 21811656 T to C
FTB26924 2840600 T to C
FTB26925 9990464 T to G
FTB26926 8752702 G to T
FTB26927 13286063 C to G
FTB26928 13662549 T to C
FTB26929 22222145 A to G
FTB26930 19081039 C to T
FTB26931 8440458 T to C
FTB26932 14508349 C to T
FTB26933 26416510 A to G
FTB26934 9305231 C to T
FTB26935 2997409 G to T
FTB26936 2997799 T to C
FTB26937 3088556 C to G
FTB26938 3088883 A to G
FTB26939 3091941 G to A
FTB26940 3099960 C to T
FTB26941 3116869 A to C
FTB26942 3116926 T to C
FTB26943 3142663 G to A
FTB26944 3146708 T to G
FTB26945 3157024 C to T
FTB26946 3189067 A to G
FTB26947 3195332 T to C
FTB26948 3197329 A to G
FTB26949 3198154 C to T
FTB26950 3203083 G to A
FTB26951 3204559 A to G
FTB26952 3209516 C to G
FTB26953 3215599 T to C
FTB26954 3220452 G to C
FTB26955 3223676 T to G
FTB26956 3224898 C to T
FTB26957 3232923 G to A
FTB26958 3233658 G to C
FTB26959 3240859 A to G
FTB26960 3260679 T to C
FTB26961 3265946 T to C
FTB26962 3272469 C to T
FTB26963 3286218 C to A
FTB26964 3297788 G to A
FTB26965 3311652 G to A
FTB26966 3320801 T to C
FTB26967 3332685 T to C
FTB26968 3351942 G to C
FTB26969 3371761 A to G
FTB26970 3384588 C to T
FTB26971 3388191 T to G
FTB26972 3408570 G to A
FTB26973 3416691 T to C
FTB26974 3417507 G to A
FTB26975 3435094 G to T
FTB26976 3516642 C to T
FTB26977 3543955 T to G
FTB26978 3557427 T to C
FTB26979 3563913 C to T
FTB26980 3568313 G to A
FTB26981 3587601 G to T
FTB26982 3604729 A to G
FTB26983 3618664 A to G
FTB26984 3622336 G to C
FTB26985 3622337 T to C
FTB26986 3623460 G to A
FTB26987 3623786 T to C
FTB26988 3653404 G to A
FTB26989 3661900 C to T
FTB26990 3662173 G to A
FTB26991 3735750 G to A
FTB26992 3735946 G to T
FTB26993 3737840 T to C
FTB26994 3750365 G to A
FTB26995 3765225 C to T
FTB26996 3765438 T to C
FTB26997 3788151 T to C
FTB26998 3791921 A to G
FTB26999 3808330 A to G
FTB27000 3821991 T to C
FTB27001 3828349 G to A
FTB27002 3830727 T to C
FTB27003 3830731 G to A
FTB27004 3838752 A to G
FTB27005 3839245 C to T
FTB27006 3872700 A to G
FTB27007 3885159 G to A
FTB27008 3892337 C to A
FTB27009 3898827 A to G
FTB27010 3911523 A to G
FTB27011 3915627 C to T
FTB27012 3940794 G to C
FTB27013 3943368 G to C
FTB27014 3974427 G to A
FTB27015 3985058 C to T
FTB27016 4031886 G to A
FTB27017 4033414 T to C
FTB27018 4040931 T to G
FTB27019 4041885 A to G
FTB27020 4052824 A to G
FTB27021 4054788 G to A
FTB27022 4062803 C to T
FTB27023 4062804 A to T
FTB27024 4082530 C to T
FTB27025 4087705 T to C
FTB27026 4094810 G to T
FTB27027 4098240 C to G
FTB27028 4105431 T to G
FTB27029 4106094 T to C
FTB27030 4154128 C to A
FTB27031 4156990 G to A
FTB27032 4161607 A to G
FTB27033 4166845 C to T
FTB27034 4171356 A to G
FTB27035 4173901 C to A
FTB27036 4177455 C to A
FTB27037 4183804 C to T
FTB27038 4189537 T to C
FTB27039 4190226 T to C
FTB27040 4205907 T to C
FTB27041 4218143 A to G
FTB27042 4221086 A to C
FTB27043 4243765 G to T
FTB27044 4255155 C to T
FTB27045 4260020 T to C
FTB27046 4274962 A to G
FTB27047 4281834 A to G
FTB27048 4284364 G to T
FTB27049 4287202 G to C
FTB27050 4295113 T to C
FTB27051 4325043 G to T
FTB27052 4353565 T to C
FTB27053 4377977 A to C
FTB27054 4380029 C to T
FTB27055 4396017 C to T
FTB27056 4398086 T to G
FTB27057 4401546 T to C
FTB27058 4447179 A to G
FTB27059 4452562 A to T
FTB27060 4455117 T to G
FTB27061 4455358 C to A
FTB27062 4468533 A to G
FTB27063 4474826 T to C
FTB27064 4484858 A to C
FTB27065 4504392 T to C
FTB27066 4518672 C to T
FTB27067 4528311 T to C
FTB27068 4535511 T to A
FTB27069 4554893 T to C
FTB27070 4573905 T to G
FTB27071 4580994 A to C
FTB27072 4593087 T to C
FTB27073 4599467 T to A
FTB27074 4607064 A to G
FTB27075 4630452 G to A
FTB27076 4631453 G to A
FTB27077 4645879 G to C
FTB27078 4657736 A to C
FTB27079 4669710 C to T
FTB27080 4673507 T to C
FTB27081 4683128 G to T
FTB27082 4688355 A to C
FTB27083 4692801 A to C
FTB27084 4693994 A to G
FTB27085 4694077 C to T
FTB27086 4695269 T to C
FTB27087 4696334 T to G
FTB27088 4703602 T to C
FTB27089 4709485 A to G
FTB27090 4715156 G to C
FTB27091 4718803 A to G
FTB27092 4723786 T to C
FTB27093 4741235 A to G
FTB27094 4793730 C to T
FTB27095 4794949 T to A
FTB27096 4800519 G to T
FTB27097 4811576 T to C
FTB27098 4813128 G to T
FTB27099 4827851 G to A
FTB27100 4839853 A to T
FTB27101 4848143 T to G
FTB27102 4876932 A to C
FTB27103 4879810 A to G
FTB27104 4886498 A to T
FTB27105 4891104 C to A
FTB27106 4920657 G to T
FTB27107 4926198 G to A
FTB27108 4946071 C to T
FTB27109 4948602 T to A
FTB27110 4958065 T to A
FTB27111 4972849 T to C
FTB27112 4989946 A to G
FTB27113 5030928 A to G
FTB27114 5064423 C to T
FTB27115 5074213 A to G
FTB27116 5087874 G to T
FTB27117 5099920 T to C
FTB27118 5105174 G to A
FTB27119 5106006 T to G
FTB27120 5114013 G to A
FTB27121 5114057 C to T
FTB27122 5127284 A to C
FTB27123 5128098 G to T
FTB27124 5137090 C to A
FTB27125 5138830 G to A
FTB27126 5148974 T to C
FTB27127 5164055 A to G
FTB27128 5174955 A to G
FTB27129 5177873 G to A
FTB27130 5179543 G to T
FTB27131 5180988 G to A
FTB27132 5220530 C to T
FTB27133 5235406 C to T
FTB27134 5284795 A to G
FTB27135 5285626 G to T
FTB27136 5289815 G to A
FTB27137 5297981 C to T
FTB27138 5307990 C to T
FTB27139 5310569 T to C
FTB27140 5335381 T to C
FTB27141 5340717 A to G
FTB27142 5343674 G to T
FTB27143 5345808 C to A
FTB27144 5353435 C to A
FTB27145 5353889 T to G
FTB27146 5362575 C to T
FTB27147 5367048 G to A
FTB27148 5386332 T to C
FTB27149 5392567 A to G
FTB27150 5394257 G to A
FTB27151 5415129 G to T
FTB27152 5427261 T to C
FTB27153 5439688 T to G
FTB27154 5441626 C to G
FTB27155 5449820 G to A
FTB27156 5455721 G to T
FTB27157 5460243 T to C
FTB27158 5465548 C to A
FTB27159 5485532 T to C
FTB27160 5519640 A to G
FTB27161 5523453 C to T
FTB27162 5526991 G to A
FTB27163 5533000 T to A
FTB27164 5534104 G to A
FTB27165 5546563 A to G
FTB27166 5551157 C to G
FTB27167 5558440 C to T
FTB27168 5572256 A to G
FTB27169 5572580 T to G
FTB27170 5576314 G to T
FTB27171 5588288 A to G
FTB27172 5593475 T to A
FTB27173 5627602 T to G
FTB27174 5629542 A to G
FTB27175 5635638 T to C
FTB27176 5636608 C to T
FTB27177 5642802 T to C
FTB27178 5676129 C to T
FTB27179 5690165 C to T
FTB27180 5716421 G to A
FTB27181 5723300 A to T
FTB27182 5727997 A to C
FTB27183 5737437 C to A
FTB27184 5755714 C to T
FTB27185 5784949 A to T
FTB27186 5796700 T to C
FTB27187 5804047 T to G
FTB27188 5817275 G to A
FTB27189 5827203 T to G
FTB27190 5827826 A to G
FTB27191 5831053 G to C
FTB27192 5878175 T to G
FTB27193 5892515 T to C
FTB27194 5900608 T to C
FTB27195 5921718 T to G
FTB27196 5923208 G to A
FTB27197 5929393 G to T
FTB27198 5930699 C to T
FTB27199 5932520 T to C
FTB27200 5958854 T to C
FTB27201 5960287 T to A
FTB27202 5964912 G to A
FTB27203 5967799 G to A
FTB27204 5978946 G to T
FTB27205 5989316 C to A
FTB27206 5995031 T to C
FTB27207 5996853 G to C
FTB27208 5998985 C to G
FTB27209 6032608 T to A
FTB27210 6056723 T to C
FTB27211 6092290 T to C
FTB27212 6096590 C to T
FTB27213 6105660 T to A
FTB27214 6108309 G to A
FTB27215 6109818 T to C
FTB27216 6117650 G to A
FTB27217 6128735 C to T
FTB27218 6131783 C to G
FTB27219 6136585 G to A
FTB27220 6151787 C to G
FTB27221 6154893 T to G
FTB27222 6167665 G to C
FTB27223 6171351 A to G
FTB27224 6172820 A to G
FTB27225 6188734 C to G
FTB27226 6194566 G to A
FTB27227 6198711 C to T
FTB27228 6203800 T to G
FTB27229 6237439 T to C
FTB27230 6244356 T to A
FTB27231 6277358 T to G
FTB27232 6285457 G to T
FTB27233 6365634 C to G
FTB27234 6411885 A to C
FTB27235 6477573 C to G
FTB27236 6485913 A to G
FTB27237 6527067 C to T
FTB27238 6532516 T to C
FTB27239 6537312 G to A
FTB27240 6576922 C to T
FTB27241 6578000 C to A
FTB27242 6585240 A to T
FTB27243 6589332 T to C
FTB27244 6598495 G to A
FTB27245 6602221 A to G
FTB27246 6614534 C to G
FTB27247 6635689 A to G
FTB27248 6637006 A to G
FTB27249 6639279 G to A
FTB27250 6647214 A to G
FTB27251 6669792 A to G
FTB27252 6707131 T to C
FTB27253 6714643 T to A
FTB27254 6727818 A to G
FTB27255 6729604 A to G
FTB27256 6734863 G to C
FTB27257 6747399 A to G
FTB27258 9055340 C to T
FTB27259 9542133 C to G
FTB27260 9543259 T to C
FTB27261 9553684 A to G
FTB27262 9554526 G to A
FTB27263 9653773 T to C
FTB27264 9670424 T to G
FTB27265 9675289 G to A
FTB27266 9739549 C to A
FTB27267 9773045 A to G
FTB27268 9782100 G to A
FTB27269 9809045 G to A
FTB27270 9811426 A to G
FTB27271 9841129 T to C
FTB27272 9893052 T to C
FTB27273 9905194 G to A
FTB27274 9908798 G to A
FTB27275 9919845 C to G
FTB27276 9929852 T to A
FTB27277 9958705 G to A
FTB27278 9985114 A to T
FTB27279 10070694 A to G
FTB27280 11690548 G to T
FTB27281 11691781 G to T
FTB27282 11693489 T to G
FTB27283 11695837 G to A
FTB27284 11700067 G to T
FTB27285 11701076 C to A
FTB27286 11710735 A to T
FTB27287 11710898 A to G
FTB27288 11715945 T to G
FTB27289 11717792 A to T
FTB27290 11717967 A to T
FTB27291 11720597 C to A
FTB27292 11724203 G to C
FTB27293 11724754 A to G
FTB27294 11735734 A to C
FTB27295 11736215 C to G
FTB27296 11736366 A to T
FTB27297 11741255 G to A
FTB27298 15894843 A to C
FTB27299 15894903 C to T
FTB27300 16180890 A to G
FTB27301 16406960 T to A
FTB27302 16410496 G to A
FTB27303 20054290 G to T
FTB27304 21483491 G to T
FTB27305 21574581 T to C
FTB27306 21753413 G to A
FTB27307 21807004 C to A
FTB27308 21807543 C to A
FTB27309 21849385 C to A
FTB27310 21850051 T to C
FTB27311 22209293 T to C
FTB27312 22217597 C to T
FTB27313 22217709 C to T
FTB27314 22356834 G to C
FTB27315 22356908 G to A
FTB27316 22366700 T to G