Page Actions

FTB SNPs 60K

From ISOGG Wiki

The FT SNP index lists Big Y-700 SNPs that have been named by Family Tree DNA as they have been considered for inclusion to the Y chromosome haplotree.

Previous List (FTB50000-FTB59999)


SNP Position (hg38) Mutation
FTB60000 12039397 T to A
FTB60001 12048533 C to A
FTB60002 12051165 C to A
FTB60003 12052539 C to T
FTB60004 12053640 G to A
FTB60005 12057215 G to A
FTB60006 12061144 A to C
FTB60007 12069488 G to A
FTB60008 12077728 C to T
FTB60009 12079383 C to T
FTB60010 12080690 T to C
FTB60011 12087240 T to G
FTB60012 12091851 C to G
FTB60013 12095688 C to T
FTB60014 12100086 A to G
FTB60015 12104328 T to G
FTB60016 12106158 A to G
FTB60017 12119426 C to T
FTB60018 12124469 A to G
FTB60019 12125575 T to C
FTB60020 12134241 G to A
FTB60021 12144021 C to T
FTB60022 12144072 G to A
FTB60023 12149858 A to G
FTB60024 12151220 T to C
FTB60025 12153560 A to G
FTB60026 12153827 A to C
FTB60027 12154018 A to G
FTB60028 12155028 C to A
FTB60029 12155351 T to A
FTB60030 12156723 C to T
FTB60031 12158404 A to T
FTB60032 12162132 T to C
FTB60033 12163078 C to A
FTB60034 12174282 T to C
FTB60035 12187990 G to A
FTB60036 12196368 T to C
FTB60037 12197103 T to A
FTB60038 12201091 G to A
FTB60039 12201094 A to G
FTB60040 12211976 G to C
FTB60041 12212119 C to T
FTB60042 12217187 T to C
FTB60043 12219564 G to A
FTB60044 12222274 A to C
FTB60045 12227686 A to C
FTB60046 12230253 G to A
FTB60047 12231240 A to T
FTB60048 12231665 T to C
FTB60049 12237866 T to C
FTB60050 12244964 T to G
FTB60051 12247619 C to A
FTB60052 12250480 G to A
FTB60053 12251085 T to A
FTB60054 12251775 A to C
FTB60055 12251890 C to T
FTB60056 12251982 C to T
FTB60057 12253498 T to C
FTB60058 12260252 C to T
FTB60059 12260513 G to A
FTB60060 12261022 G to C
FTB60061 12262634 A to G
FTB60062 12269264 G to A
FTB60063 12286901 C to T
FTB60064 12292222 G to C
FTB60065 12294835 C to T
FTB60066 12309779 A to T
FTB60067 12317517 G to A
FTB60068 12357365 G to A
FTB60069 12359652 G to T
FTB60070 12375155 G to A
FTB60071 12385164 C to A
FTB60072 12386794 C to T
FTB60073 12387099 T to A
FTB60074 12392396 T to G
FTB60075 12409505 C to A
FTB60076 12412340 T to C
FTB60077 12417228 G to C
FTB60078 12424420 T to C
FTB60079 12431640 C to T
FTB60080 12433777 G to T
FTB60081 12439009 C to T
FTB60082 12450728 C to A
FTB60083 12459125 G to A
FTB60084 12465958 C to G
FTB60085 12471480 G to A
FTB60086 12471846 C to A
FTB60087 12474548 A to G
FTB60088 12475105 T to C
FTB60089 12482586 C to A
FTB60090 12485420 G to A
FTB60091 12493879 G to A
FTB60092 12503111 T to G
FTB60093 12516220 G to T
FTB60094 12525049 C to T
FTB60095 12533425 G to T
FTB60096 12539632 T to C
FTB60097 12543874 T to C
FTB60098 12548206 C to A
FTB60099 12553352 A to G
FTB60100 12562648 G to A
FTB60101 12580295 C to G
FTB60102 12586545 A to C
FTB60103 12587016 A to G
FTB60104 12593774 T to C
FTB60105 12607928 C to T
FTB60106 12608314 G to A
FTB60107 12610608 G to T
FTB60108 12610929 T to A
FTB60109 12640958 T to G
FTB60110 12641435 G to T
FTB60111 12643441 G to A
FTB60112 12644576 G to A
FTB60113 12647112 C to G
FTB60114 12657911 T to G
FTB60115 12670347 A to G
FTB60116 12689325 T to C
FTB60117 12692918 C to G
FTB60118 12715566 C to T
FTB60119 12715603 C to T
FTB60120 12715661 A to G
FTB60121 12735263 T to C
FTB60122 12735601 C to G
FTB60123 12737890 A to C
FTB60124 12750977 A to G
FTB60125 12764499 A to G
FTB60126 12772250 A to G
FTB60127 12781405 C to G
FTB60128 12782346 A to C
FTB60129 12783598 C to T
FTB60130 12788710 G to A
FTB60131 12790533 G to A
FTB60132 12803482 C to A
FTB60133 12809298 T to G
FTB60134 12816823 C to G
FTB60135 12825559 G to C
FTB60136 12829269 T to C
FTB60137 12834093 G to A
FTB60138 12834276 C to T
FTB60139 12839171 C to G
FTB60140 12846477 G to A
FTB60141 12852804 A to C
FTB60142 12859046 T to C
FTB60143 12864805 A to G
FTB60144 12875329 G to A
FTB60145 12881351 C to A
FTB60146 12886522 C to T
FTB60147 12905456 G to C
FTB60148 12915033 T to A
FTB60149 12915994 C to A
FTB60150 12934885 A to G
FTB60151 12945855 A to G
FTB60152 12954276 G to A
FTB60153 12955295 C to G
FTB60154 12958659 T to C
FTB60155 12958932 A to G
FTB60156 12963034 A to G
FTB60157 12967031 T to G
FTB60158 12974465 T to A
FTB60159 12983320 C to T
FTB60160 12999965 A to G
FTB60161 13012040 T to C
FTB60162 13031703 C to T
FTB60163 13049799 G to A
FTB60164 13061148 A to G
FTB60165 13062859 A to G
FTB60166 13069016 T to C
FTB60167 13082558 G to T
FTB60168 13092324 C to T
FTB60169 13116950 C to T
FTB60170 13120591 C to T
FTB60171 13128921 C to T
FTB60172 13142958 C to T
FTB60173 13157580 C to T
FTB60174 13158321 C to G
FTB60175 13160255 T to C
FTB60176 13162809 C to T
FTB60177 13167980 T to C
FTB60178 13171305 T to C
FTB60179 13177794 A to G
FTB60180 13192187 A to T
FTB60181 13197782 A to G
FTB60182 13212711 G to A
FTB60183 13215257 C to T
FTB60184 13216798 T to C
FTB60185 13218862 A to C
FTB60186 13222214 A to G
FTB60187 13232590 T to G
FTB60188 13249118 A to C
FTB60189 13250367 T to C
FTB60190 13250877 T to C
FTB60191 13258548 C to T
FTB60192 13269753 A to G
FTB60193 13272344 A to G
FTB60194 13276615 G to A
FTB60195 13279001 C to G
FTB60196 13286200 C to G
FTB60197 13287022 G to A
FTB60198 13293577 A to T
FTB60199 13301936 T to G
FTB60200 13302559 A to G
FTB60201 13307217 T to C
FTB60202 13308119 G to T
FTB60203 13309461 T to C
FTB60204 13309486 G to T
FTB60205 13310185 C to T
FTB60206 13310407 G to A
FTB60207 13314966 C to A
FTB60208 13316447 G to A
FTB60209 13319211 C to A
FTB60210 13323726 T to G
FTB60211 13328489 C to T
FTB60212 13329164 C to T
FTB60213 13337315 C to T
FTB60214 13342267 T to C
FTB60215 13343873 A to G
FTB60216 13344914 A to C
FTB60217 13363452 C to A
FTB60218 13366357 T to C
FTB60219 13383568 C to T
FTB60220 13385314 A to G
FTB60221 13401378 A to G
FTB60222 13404035 C to T
FTB60223 13406566 C to A
FTB60224 13411281 C to T
FTB60225 13428122 A to G
FTB60226 13437460 A to G
FTB60227 13446021 T to C
FTB60228 13451476 A to C
FTB60229 13456440 T to A
FTB60230 13457473 C to G
FTB60231 13469919 A to G
FTB60232 13476235 T to C
FTB60233 13489194 C to T
FTB60234 13496490 C to T
FTB60235 13498789 C to G
FTB60236 13499403 A to C
FTB60237 13511622 T to G
FTB60238 13547671 A to T
FTB60239 13549976 G to C
FTB60240 13550590 A to C
FTB60241 13556186 G to A
FTB60242 13556223 G to A
FTB60243 13558795 C to T
FTB60244 13584140 G to A
FTB60245 13591221 C to G
FTB60246 13597323 G to A
FTB60247 13600288 G to A
FTB60248 13602914 G to A
FTB60249 13606425 A to G
FTB60250 13608589 C to T
FTB60251 13610869 A to G
FTB60252 13612007 C to T
FTB60253 13612194 C to T
FTB60254 13612982 G to A
FTB60255 13613069 T to C
FTB60256 13613427 C to G
FTB60257 13621141 T to G
FTB60258 13623860 C to T
FTB60259 13625791 T to A
FTB60260 13629551 C to G
FTB60261 13630447 A to T
FTB60262 13635359 C to T
FTB60263 13644632 C to T
FTB60264 13661146 T to C
FTB60265 13662024 C to T
FTB60266 13664905 G to A
FTB60267 13668472 T to C
FTB60268 13675241 G to A
FTB60269 13679071 A to C
FTB60270 13680458 C to A
FTB60271 13685409 A to T
FTB60272 13688428 T to A
FTB60273 13698206 A to G
FTB60274 13710475 G to T
FTB60275 13711777 C to G
FTB60276 13719401 G to A
FTB60277 13730863 A to G
FTB60278 13730881 T to A
FTB60279 13733772 C to T
FTB60280 13737533 T to A
FTB60281 13739254 A to G
FTB60282 13757085 A to T
FTB60283 13763651 G to A
FTB60284 13769104 G to A
FTB60285 13770650 G to T
FTB60286 13775971 A to G
FTB60287 13802686 C to T
FTB60288 13810191 T to A
FTB60289 13821893 G to A
FTB60290 13825570 G to C
FTB60291 13827786 G to A
FTB60292 13839596 A to C
FTB60293 13845208 A to G
FTB60294 13851947 C to A
FTB60295 13855117 A to G
FTB60296 13877447 T to C
FTB60297 13889882 C to G
FTB60298 13902861 T to A
FTB60299 13904979 G to A
FTB60300 13907882 A to G
FTB60301 13915460 T to C
FTB60302 13933025 T to G
FTB60303 13935813 C to G
FTB60304 13943956 C to T
FTB60305 13946602 T to G
FTB60306 13946621 G to T
FTB60307 13947678 A to G
FTB60308 13948213 T to A
FTB60309 13950745 T to C
FTB60310 13957871 G to C
FTB60311 13960344 G to A
FTB60312 13964431 G to A
FTB60313 13966464 G to A
FTB60314 13966603 T to G
FTB60315 13977406 T to C
FTB60316 13979984 A to G
FTB60317 14061912 C to T
FTB60318 14076943 C to T
FTB60319 14077802 T to C
FTB60320 14086597 G to A
FTB60321 14090201 T to C
FTB60322 14102502 C to T
FTB60323 14105428 C to G
FTB60324 14107697 A to G
FTB60325 14126702 G to T
FTB60326 14131012 T to C
FTB60327 14134765 T to C
FTB60328 14137522 C to T
FTB60329 14145816 A to G
FTB60330 14146743 C to T
FTB60331 14150883 A to G
FTB60332 14158543 G to C
FTB60333 14163299 C to G
FTB60334 14169092 T to G
FTB60335 14172165 T to C
FTB60336 14177451 G to C
FTB60337 14198327 A to G
FTB60338 14202717 G to A
FTB60339 14206147 C to G
FTB60340 14212562 G to A
FTB60341 14215823 T to C
FTB60342 14216508 G to A
FTB60343 14217360 A to G
FTB60344 14222405 T to A
FTB60345 14225412 A to T
FTB60346 14237281 C to T
FTB60347 14239111 T to C
FTB60348 14239484 G to T
FTB60349 14239837 G to C
FTB60350 14252454 T to C
FTB60351 14257115 G to A
FTB60352 14260283 G to C
FTB60353 14260284 G to C
FTB60354 14274685 G to C
FTB60355 14274824 C to G
FTB60356 14277045 C to A
FTB60357 14291916 A to C
FTB60358 14295929 T to C
FTB60359 14308899 A to T
FTB60360 14311246 T to C
FTB60361 14313266 C to A
FTB60362 14313460 C to G
FTB60363 14317796 G to A
FTB60364 14318032 C to G
FTB60365 14318060 G to T
FTB60366 14333103 C to T
FTB60367 14340157 A to G
FTB60368 14341429 G to A
FTB60369 14344358 C to T
FTB60370 14344508 G to C
FTB60371 14345116 C to T
FTB60372 14360061 A to G
FTB60373 14362528 T to C
FTB60374 14392931 G to T
FTB60375 14393967 C to G
FTB60376 14413660 A to C
FTB60377 14414294 C to G
FTB60378 14421383 A to G
FTB60379 14424976 A to C
FTB60380 14432878 A to T
FTB60381 14435166 A to G
FTB60382 14436547 T to A
FTB60383 14437060 T to G
FTB60384 14445133 T to C
FTB60385 14446327 C to A
FTB60386 14470676 G to T
FTB60387 14481557 C to T
FTB60388 14482052 A to G
FTB60389 14486016 G to C
FTB60390 14487100 T to A
FTB60391 14490693 A to C
FTB60392 14495557 A to T
FTB60393 14503183 G to C
FTB60394 14503657 G to C
FTB60395 14508376 C to A
FTB60396 14512969 C to T
FTB60397 14516838 T to C
FTB60398 14523746 T to G
FTB60399 14525135 A to G
FTB60400 14525271 T to C
FTB60401 14530121 A to G
FTB60402 14548219 T to G
FTB60403 14550027 G to T
FTB60404 14550307 C to A
FTB60405 14553549 T to C
FTB60406 14554041 T to C
FTB60407 14557850 T to G
FTB60408 14559089 A to C
FTB60409 14565268 C to T
FTB60410 14565343 A to C
FTB60411 14569436 A to G
FTB60412 14580272 A to C
FTB60413 14581785 T to C
FTB60414 14582707 A to G
FTB60415 14585449 C to A
FTB60416 14586307 G to A
FTB60417 14588544 T to C
FTB60418 14591760 A to G
FTB60419 14598256 C to T
FTB60420 14598268 T to G
FTB60421 14603196 G to C
FTB60422 14604091 G to A
FTB60423 14604761 C to T
FTB60424 14618355 C to A
FTB60425 14624097 G to T
FTB60426 14626981 G to A
FTB60427 14629955 T to C
FTB60428 14637040 A to G
FTB60429 14646016 G to A
FTB60430 14653138 C to T
FTB60431 14653250 A to T
FTB60432 14653916 A to G
FTB60433 14663333 C to T
FTB60434 14668450 G to A
FTB60435 14669987 T to C
FTB60436 14678408 C to T
FTB60437 14679389 G to C
FTB60438 14681462 T to C
FTB60439 14682158 C to A
FTB60440 14686388 C to T
FTB60441 14687303 G to A
FTB60442 14692016 T to C
FTB60443 14692682 T to C
FTB60444 14701913 T to A
FTB60445 14714195 C to T
FTB60446 14728594 C to T
FTB60447 14728756 A to G
FTB60448 14729013 T to C
FTB60449 14737663 T to C
FTB60450 14741545 T to C
FTB60451 14741854 G to T
FTB60452 14750460 C to G
FTB60453 14758815 G to T
FTB60454 14761968 T to C
FTB60455 14768913 A to G
FTB60456 14772219 A to G
FTB60457 14772649 C to T
FTB60458 14774218 G to A
FTB60459 14775094 A to G
FTB60460 14775905 G to A
FTB60461 14777967 G to C
FTB60462 14784180 C to G
FTB60463 14800855 C to T
FTB60464 14802430 C to T
FTB60465 14813586 T to A
FTB60466 14816280 G to A
FTB60467 14818277 A to G
FTB60468 14826072 A to G
FTB60469 14828578 G to A
FTB60470 14830242 G to T
FTB60471 14836094 T to C
FTB60472 14841174 G to C
FTB60473 14849929 C to A
FTB60474 14857908 A to G
FTB60475 14878669 A to G
FTB60476 14881874 G to T
FTB60477 14890025 G to A
FTB60478 14890418 T to C
FTB60479 14897634 T to C
FTB60480 14899801 A to G
FTB60481 14902036 T to C
FTB60482 14902792 A to T
FTB60483 14908597 A to G
FTB60484 14910189 T to C
FTB60485 14910452 A to T
FTB60486 14916543 T to G
FTB60487 14916572 G to C
FTB60488 14919583 T to A
FTB60489 14920125 G to T
FTB60490 14929637 T to C
FTB60491 14936477 G to T
FTB60492 14940112 C to T
FTB60493 14975644 A to C
FTB60494 14977482 C to T
FTB60495 14987357 G to A
FTB60496 14990108 C to T
FTB60497 15002425 T to C
FTB60498 15002762 T to C
FTB60499 15024024 C to T
FTB60500 15024496 A to T
FTB60501 15030909 T to G
FTB60502 15053091 C to G
FTB60503 15053846 A to G
FTB60504 15067126 G to A
FTB60505 15082160 T to C
FTB60506 15089035 C to G
FTB60507 15092825 G to A
FTB60508 15093586 G to T
FTB60509 15116344 G to A
FTB60510 15125343 A to G
FTB60511 15131177 C to T
FTB60512 15141118 T to C
FTB60513 15141644 C to T
FTB60514 15144268 G to T
FTB60515 15182492 T to C
FTB60516 15187636 T to C
FTB60517 15188795 C to G
FTB60518 15188796 C to T
FTB60519 15188799 G to C
FTB60520 15198909 T to G
FTB60521 15198939 A to G
FTB60522 15208772 G to A
FTB60523 15219230 G to A
FTB60524 15225368 C to T
FTB60525 15230691 T to C
FTB60526 15232750 A to G
FTB60527 15234384 T to A
FTB60528 15234920 T to G
FTB60529 15241006 G to A
FTB60530 15241578 T to C
FTB60531 15249359 A to G
FTB60532 15261958 C to T
FTB60533 15262173 T to C
FTB60534 15264915 G to A
FTB60535 15265395 G to C
FTB60536 15279380 G to A
FTB60537 15281303 C to A
FTB60538 15287327 A to G
FTB60539 15288368 C to T
FTB60540 15288673 C to T
FTB60541 15291265 T to C
FTB60542 15304701 C to G
FTB60543 15309291 C to T
FTB60544 15310109 T to C
FTB60545 15323129 G to A
FTB60546 15323592 C to T
FTB60547 15326238 C to T
FTB60548 15326749 T to C
FTB60549 15338169 T to G
FTB60550 15343875 G to C
FTB60551 15346526 G to A
FTB60552 15349575 A to C
FTB60553 15353514 A to T
FTB60554 15362960 A to C
FTB60555 15369383 C to G
FTB60556 15375254 A to G
FTB60557 15377577 C to G
FTB60558 15384409 G to C
FTB60559 15392198 T to A
FTB60560 15392975 C to G
FTB60561 15403644 T to C
FTB60562 15432911 C to T
FTB60563 15434103 G to T
FTB60564 15438658 G to A
FTB60565 15439918 T to A
FTB60566 15445124 G to A
FTB60567 15455737 A to G
FTB60568 15458974 G to T
FTB60569 15463374 G to A
FTB60570 15470307 T to A
FTB60571 15482820 A to G
FTB60572 15483639 C to G
FTB60573 15484561 G to A
FTB60574 15487257 G to A
FTB60575 15494636 T to C
FTB60576 15495577 T to C
FTB60577 15502500 T to A
FTB60578 15516408 T to A
FTB60579 15526075 C to A
FTB60580 15528211 C to T
FTB60581 15537400 T to G
FTB60582 15540105 G to A
FTB60583 15542110 G to A
FTB60584 15544117 T to C
FTB60585 15549266 G to T
FTB60586 15568269 G to T
FTB60587 15572981 C to T
FTB60588 15580732 A to G
FTB60589 15583026 T to C
FTB60590 15590562 A to C
FTB60591 15593363 T to C
FTB60592 15593607 C to T
FTB60593 15604034 C to A
FTB60594 15605161 C to T
FTB60595 15608540 A to C
FTB60596 15617624 C to T
FTB60597 15628035 T to C
FTB60598 15629596 T to C
FTB60599 15632581 C to A
FTB60600 15633988 T to C
FTB60601 15634700 G to T
FTB60602 15637814 C to T
FTB60603 15650667 C to T
FTB60604 15654337 G to T
FTB60605 15654645 A to C
FTB60606 15655606 T to C
FTB60607 15665158 C to T
FTB60608 15676095 G to C
FTB60609 15689727 G to A
FTB60610 15694330 G to C
FTB60611 15696498 A to C
FTB60612 15702061 A to T
FTB60613 15703930 G to C
FTB60614 15708778 G to T
FTB60615 15720564 A to G
FTB60616 15728274 C to T
FTB60617 15728692 G to T
FTB60618 15730098 G to C
FTB60619 15731927 A to C
FTB60620 15734882 C to A
FTB60621 15735299 A to G
FTB60622 15739587 G to A
FTB60623 15745599 G to C
FTB60624 15750549 G to A
FTB60625 15752235 G to A
FTB60626 15765762 G to T
FTB60627 15774732 A to G
FTB60628 15776493 G to A
FTB60629 15780079 T to A
FTB60630 15782278 T to C
FTB60631 15792352 T to A
FTB60632 15796745 C to T
FTB60633 15808341 G to C
FTB60634 15808865 A to C
FTB60635 15814250 A to G
FTB60636 15817540 A to G
FTB60637 15820532 A to C
FTB60638 15822924 G to A
FTB60639 15825230 C to T
FTB60640 15831716 A to G
FTB60641 15835634 T to C
FTB60642 15840682 G to A
FTB60643 15844811 T to C
FTB60644 15859107 G to A
FTB60645 15871520 A to G
FTB60646 15891818 A to G
FTB60647 15906678 A to T
FTB60648 15908481 G to A
FTB60649 15932463 C to T
FTB60650 15933828 C to G
FTB60651 15934302 G to T
FTB60652 15935446 A to C
FTB60653 15935744 G to T
FTB60654 15936513 A to T
FTB60655 15946841 C to T
FTB60656 15952048 T to A
FTB60657 15953029 C to T
FTB60658 15953314 A to G
FTB60659 15962227 A to C
FTB60660 15962985 A to G
FTB60661 15965103 G to A
FTB60662 15974223 G to A
FTB60663 15979031 A to C
FTB60664 15980416 T to C
FTB60665 15983278 C to T
FTB60666 15987728 C to T
FTB60667 15991235 T to C
FTB60668 15997755 T to C
FTB60669 15997859 G to T
FTB60670 16003523 C to A
FTB60671 16007651 C to A
FTB60672 16023486 C to T
FTB60673 16039253 A to G
FTB60674 16040389 T to C
FTB60675 16054946 G to A
FTB60676 16062115 A to T
FTB60677 16066178 A to G
FTB60678 16073973 A to G
FTB60679 16075359 G to T
FTB60680 16076673 A to C
FTB60681 16078810 A to G
FTB60682 16082575 T to C
FTB60683 16091982 C to A
FTB60684 16092805 T to A
FTB60685 16097794 T to C
FTB60686 16099061 T to C
FTB60687 16099913 T to C
FTB60688 16103813 C to T
FTB60689 16104039 A to G
FTB60690 16106395 A to C
FTB60691 16132567 C to T
FTB60692 16135263 C to T
FTB60693 16145977 C to G
FTB60694 16146011 C to T
FTB60695 16147603 C to G
FTB60696 16157260 C to A
FTB60697 16157346 G to A
FTB60698 16274700 A to T
FTB60699 16274944 C to A
FTB60700 16278923 T to C
FTB60701 16279057 A to G
FTB60702 16288355 A to G
FTB60703 16289214 G to T
FTB60704 16295175 G to A
FTB60705 16300306 A to T
FTB60706 16309718 G to A
FTB60707 16310784 A to G
FTB60708 16311670 A to T
FTB60709 16312702 T to G
FTB60710 16313386 G to C
FTB60711 16313719 G to A
FTB60712 16427016 G to A
FTB60713 16436378 A to T
FTB60714 16440200 C to T
FTB60715 16444987 C to T
FTB60716 16450862 T to C
FTB60717 16459195 T to C
FTB60718 16470310 C to T
FTB60719 16487822 C to A
FTB60720 16488839 C to A
FTB60721 16491803 G to C
FTB60722 16493514 G to A
FTB60723 16503384 G to T
FTB60724 16503964 C to T
FTB60725 16514876 A to T
FTB60726 16515281 A to C
FTB60727 16518051 C to A
FTB60728 16531294 C to T
FTB60729 16532097 T to C
FTB60730 16533059 C to T
FTB60731 16541612 A to G
FTB60732 16546582 C to A
FTB60733 16549745 C to T
FTB60734 16550155 T to C
FTB60735 16553659 G to A
FTB60736 16559128 C to T
FTB60737 16559487 T to C
FTB60738 16560972 G to A
FTB60739 16562699 T to C
FTB60740 16563684 A to C
FTB60741 16563869 C to G
FTB60742 16565153 A to T
FTB60743 16586373 A to G
FTB60744 16588045 T to G
FTB60745 16591967 G to A
FTB60746 16601014 G to A
FTB60747 16603773 G to C
FTB60748 16605147 G to A
FTB60749 16605293 T to C
FTB60750 16605872 A to G
FTB60751 16609405 C to T
FTB60752 16609881 G to A
FTB60753 16611388 T to C
FTB60754 16615767 G to T
FTB60755 16619793 A to G
FTB60756 16629917 C to T
FTB60757 16630790 T to C
FTB60758 16635184 G to A
FTB60759 16638620 A to G
FTB60760 16639174 T to C
FTB60761 16649873 A to G
FTB60762 16652824 G to A
FTB60763 16659695 G to A
FTB60764 16659945 C to A
FTB60765 16669923 C to T
FTB60766 16670767 A to G
FTB60767 16670905 G to C
FTB60768 16696663 G to C
FTB60769 16700242 C to G
FTB60770 16713070 G to T
FTB60771 16715602 A to G
FTB60772 16734376 T to C
FTB60773 16734433 C to T
FTB60774 16737704 C to G
FTB60775 16745828 C to G
FTB60776 16746000 C to T
FTB60777 16753187 T to G
FTB60778 16754727 G to A
FTB60779 16755299 G to A
FTB60780 16758222 G to A
FTB60781 16773194 T to G
FTB60782 16780346 A to C
FTB60783 16791095 C to T
FTB60784 16798224 A to G
FTB60785 16798987 C to G
FTB60786 16798988 C to T
FTB60787 16803066 G to T
FTB60788 16811077 T to C
FTB60789 16813139 G to A
FTB60790 16813828 T to A
FTB60791 16818762 C to T
FTB60792 16825695 G to A
FTB60793 16826713 T to C
FTB60794 16830320 G to A
FTB60795 16840768 T to A
FTB60796 16843561 A to G
FTB60797 16844347 C to A
FTB60798 16844795 T to C
FTB60799 16849045 G to A
FTB60800 16852269 C to A
FTB60801 16854103 C to G
FTB60802 16864842 A to G
FTB60803 16873178 T to C
FTB60804 16876629 C to G
FTB60805 16881557 C to A
FTB60806 16883276 T to C
FTB60807 16883489 A to G
FTB60808 16883682 A to G
FTB60809 16887565 G to A
FTB60810 16889894 A to T
FTB60811 16899692 C to A
FTB60812 16899916 T to C
FTB60813 16909091 A to T
FTB60814 16909953 C to G
FTB60815 16911413 C to A
FTB60816 16919312 G to T
FTB60817 16934149 A to G
FTB60818 16937900 A to G
FTB60819 16939186 T to G
FTB60820 16944540 A to G
FTB60821 16947752 C to A
FTB60822 16952705 T to C
FTB60823 16953941 G to A
FTB60824 16957883 C to T
FTB60825 16961863 G to A
FTB60826 16965111 T to A
FTB60827 16965304 T to A
FTB60828 16965467 A to T
FTB60829 16969374 C to A
FTB60830 16975392 G to A
FTB60831 16975922 A to G
FTB60832 16977994 G to A
FTB60833 16983163 G to T
FTB60834 16997072 A to G
FTB60835 16997338 G to A
FTB60836 16999058 G to T
FTB60837 17000112 G to A
FTB60838 17003715 G to A
FTB60839 17015004 A to G
FTB60840 17018143 C to T
FTB60841 17018813 C to T
FTB60842 17027879 C to T
FTB60843 17027905 A to G
FTB60844 17030557 C to T
FTB60845 17041388 G to A
FTB60846 17047800 A to T
FTB60847 17049077 C to G
FTB60848 17049763 G to A
FTB60849 17050717 A to G
FTB60850 17054377 A to G
FTB60851 17058990 G to T
FTB60852 17077005 A to C
FTB60853 17078384 C to T
FTB60854 17090110 C to T
FTB60855 17091499 G to A
FTB60856 17096335 T to A
FTB60857 17101569 C to T
FTB60858 17103579 A to G
FTB60859 17104037 T to A
FTB60860 17104728 C to G
FTB60861 17106453 C to T
FTB60862 17110888 A to C
FTB60863 17112547 C to T
FTB60864 17115332 G to A
FTB60865 17137560 C to T
FTB60866 17142167 G to T
FTB60867 17146623 A to G
FTB60868 17147145 C to T
FTB60869 17148692 C to T
FTB60870 17150101 C to G
FTB60871 17150474 C to T
FTB60872 17153262 T to C
FTB60873 17154145 T to G
FTB60874 17155160 A to G
FTB60875 17156874 T to C
FTB60876 17157080 A to C
FTB60877 17174422 A to G
FTB60878 17182631 A to G
FTB60879 17185785 T to C
FTB60880 17188242 G to C
FTB60881 17189285 A to C
FTB60882 17191307 A to C
FTB60883 17195467 C to T
FTB60884 17196285 A to G
FTB60885 17201341 C to A
FTB60886 17207676 C to A
FTB60887 17222490 T to A
FTB60888 17243049 T to A
FTB60889 17244307 T to C
FTB60890 17249940 G to A
FTB60891 17255742 A to T
FTB60892 17258926 C to T
FTB60893 17261129 G to T
FTB60894 17267704 G to C
FTB60895 17269384 T to C
FTB60896 17273092 A to G
FTB60897 17280899 T to C
FTB60898 17295575 T to G
FTB60899 17298716 T to C
FTB60900 17305154 A to C
FTB60901 17318140 C to T
FTB60902 17318834 C to T
FTB60903 17327678 G to A
FTB60904 17328170 C to T
FTB60905 17335688 C to T
FTB60906 17338108 A to C
FTB60907 17341080 G to T
FTB60908 17343339 G to A
FTB60909 17344178 G to A
FTB60910 17351719 A to C
FTB60911 17352332 T to G
FTB60912 17364216 A to T
FTB60913 17366358 T to A
FTB60914 17372961 G to A
FTB60915 17378432 G to A
FTB60916 17378699 C to T
FTB60917 17382669 A to T
FTB60918 17382746 T to C
FTB60919 17401542 C to T
FTB60920 17406547 A to G
FTB60921 17416239 C to T
FTB60922 17417734 C to T
FTB60923 17419587 G to T
FTB60924 17420777 C to T
FTB60925 17425490 A to G
FTB60926 17431678 T to C
FTB60927 17431914 C to T
FTB60928 17438000 C to G
FTB60929 17439422 T to C
FTB60930 17443501 G to A
FTB60931 17445905 T to C
FTB60932 17451354 T to A
FTB60933 17454544 G to T
FTB60934 18651934 C to T
FTB60935 18654413 T to C
FTB60936 18676318 T to C
FTB60937 18871189 T to C
FTB60938 18878154 C to A
FTB60939 18881200 C to T
FTB60940 18885194 A to T
FTB60941 18907342 G to T
FTB60942 18907438 A to G
FTB60943 18910992 C to T
FTB60944 18911707 G to A
FTB60945 18916047 A to C
FTB60946 18917922 C to G
FTB60947 18920482 A to C
FTB60948 18924996 T to C
FTB60949 18929122 T to C
FTB60950 18935955 T to C
FTB60951 18945632 T to A
FTB60952 18946605 G to T
FTB60953 18947311 T to C
FTB60954 18951313 T to C
FTB60955 18953760 G to A
FTB60956 18953999 G to C
FTB60957 18959585 G to A
FTB60958 18965942 G to T
FTB60959 18974250 T to C
FTB60960 18983250 T to C
FTB60961 18988494 T to C
FTB60962 18991384 G to C
FTB60963 18992735 T to A
FTB60964 18993037 C to A
FTB60965 19005708 A to G
FTB60966 19007794 A to G
FTB60967 19014445 C to T
FTB60968 19016778 A to T
FTB60969 19025623 C to A
FTB60970 19025903 T to C
FTB60971 19028247 A to G
FTB60972 19029432 T to G
FTB60973 19038932 A to T
FTB60974 19040397 T to C
FTB60975 19045642 G to C
FTB60976 19065033 G to T
FTB60977 19065095 C to T
FTB60978 19067539 T to C
FTB60979 19070620 T to C
FTB60980 19077736 C to A
FTB60981 19089211 A to C
FTB60982 19092681 A to T
FTB60983 19096290 A to G
FTB60984 19098843 G to A
FTB60985 19101197 G to A
FTB60986 19103001 A to C
FTB60987 19104627 C to A
FTB60988 19105303 A to G
FTB60989 19117528 G to A
FTB60990 19123453 G to A
FTB60991 19127694 A to G
FTB60992 19129309 G to A
FTB60993 19130936 A to G
FTB60994 19134342 G to A
FTB60995 19145153 C to T
FTB60996 19156075 A to G
FTB60997 19158590 G to A
FTB60998 19163215 A to G
FTB60999 19164034 T to C
FTB61000 19167221 C to T
FTB61001 19179815 C to T
FTB61002 19180381 G to T
FTB61003 19180716 G to A
FTB61004 19191741 C to T
FTB61005 19196506 A to G
FTB61006 19199914 T to C
FTB61007 19209393 T to C
FTB61008 19226509 G to T
FTB61009 19228138 G to C
FTB61010 19232692 C to T
FTB61011 19233489 C to G
FTB61012 19243756 T to G
FTB61013 19245931 G to A
FTB61014 19246693 A to C
FTB61015 19253088 C to G
FTB61016 19261489 G to T
FTB61017 19265535 A to G
FTB61018 19267538 T to G
FTB61019 19268107 G to A
FTB61020 19269248 C to T
FTB61021 19271030 C to T
FTB61022 19274987 A to G
FTB61023 19278745 A to C
FTB61024 19282056 T to C
FTB61025 19290054 T to C
FTB61026 19290192 G to A
FTB61027 19293964 G to A
FTB61028 19295928 A to G
FTB61029 19303266 T to C
FTB61030 19304451 T to C
FTB61031 19306992 G to A
FTB61032 19310849 A to G
FTB61033 19311092 A to T
FTB61034 19311598 G to C
FTB61035 19314601 C to T
FTB61036 19315442 C to A
FTB61037 19315732 G to A
FTB61038 19317784 A to T
FTB61039 19319260 C to T
FTB61040 19324365 T to C
FTB61041 19324378 T to C
FTB61042 19333288 A to G
FTB61043 19340799 A to T
FTB61044 19348087 A to C
FTB61045 19349541 T to A
FTB61046 19350181 T to A
FTB61047 19355144 T to A
FTB61048 19359579 G to T
FTB61049 19360711 A to T
FTB61050 19363104 C to G
FTB61051 19363918 T to C
FTB61052 19364935 T to C
FTB61053 19370696 C to T
FTB61054 19379189 G to T
FTB61055 19381746 G to T
FTB61056 19383102 G to T
FTB61057 19384244 G to A
FTB61058 19387761 C to G
FTB61059 19388600 T to C
FTB61060 19388843 G to A
FTB61061 19388957 T to C
FTB61062 19390071 G to A
FTB61063 19400661 A to T
FTB61064 19408490 C to T
FTB61065 19411953 A to G
FTB61066 19421582 G to A
FTB61067 19424466 A to G
FTB61068 19429769 T to G
FTB61069 19435420 G to C
FTB61070 19445542 C to T
FTB61071 19460372 T to G
FTB61072 19465837 T to A
FTB61073 19482868 T to C
FTB61074 19514160 G to A
FTB61075 19514582 G to T
FTB61076 19520252 G to C
FTB61077 19527122 C to G
FTB61078 19551682 T to C
FTB61079 19552794 C to T
FTB61080 19562813 G to A
FTB61081 19565268 G to A
FTB61082 19569830 C to T
FTB61083 19573857 A to G
FTB61084 19576755 C to A
FTB61085 19608383 T to A
FTB61086 19612819 C to G
FTB61087 19613721 G to T
FTB61088 19622416 G to C
FTB61089 19622927 C to G
FTB61090 19629026 A to C
FTB61091 19639803 T to G
FTB61092 19640551 A to G
FTB61093 19644493 T to C
FTB61094 19646796 G to A
FTB61095 19649293 C to A
FTB61096 19650757 A to C
FTB61097 19656327 C to A
FTB61098 19657126 T to C
FTB61099 19658725 G to T
FTB61100 19662092 G to A
FTB61101 19662126 A to G
FTB61102 19666010 C to A
FTB61103 19666293 G to A
FTB61104 19666722 G to A
FTB61105 19672344 C to T
FTB61106 19672565 G to A
FTB61107 19675141 C to A
FTB61108 19675402 G to T
FTB61109 19682934 C to T
FTB61110 19686872 T to C
FTB61111 19692416 T to C
FTB61112 19700537 C to T
FTB61113 19710041 C to T
FTB61114 19710164 G to C
FTB61115 19717963 T to C
FTB61116 19726556 G to C
FTB61117 19727640 G to A
FTB61118 19731292 G to C
FTB61119 19732912 T to C
FTB61120 19735745 C to T
FTB61121 19736373 A to C
FTB61122 19746908 G to A
FTB61123 19756108 T to C
FTB61124 19758897 A to G
FTB61125 19763318 A to G
FTB61126 19775480 G to T
FTB61127 19785535 T to G
FTB61128 19791945 A to G
FTB61129 19797797 G to A
FTB61130 19800214 A to C
FTB61131 19801645 T to A
FTB61132 19809900 G to T
FTB61133 19809902 A to T
FTB61134 19811453 C to G
FTB61135 19820591 A to G
FTB61136 19826203 C to A
FTB61137 19827175 A to G
FTB61138 19830179 A to T
FTB61139 19840216 C to G
FTB61140 19843078 C to G
FTB61141 19847994 T to A
FTB61142 19862593 G to A
FTB61143 19877456 T to C
FTB61144 19884206 A to G
FTB61145 19889455 A to C
FTB61146 19890894 T to G
FTB61147 19899594 C to T
FTB61148 19907511 G to T
FTB61149 19925675 A to C
FTB61150 19932416 G to A
FTB61151 19934013 C to T
FTB61152 19944200 G to C
FTB61153 19947388 G to A
FTB61154 19949060 G to A
FTB61155 19962616 T to C
FTB61156 19964189 C to A
FTB61157 19966425 T to G
FTB61158 19970360 A to G
FTB61159 19977256 T to G
FTB61160 19978287 C to T
FTB61161 19983278 A to G
FTB61162 19987631 T to C
FTB61163 19987739 C to A
FTB61164 19993245 G to A
FTB61165 19998650 A to G
FTB61166 20000453 G to T
FTB61167 20004294 T to A
FTB61168 20010869 G to A
FTB61169 20015559 G to C
FTB61170 20016001 A to C
FTB61171 20016045 G to T
FTB61172 20019009 A to G
FTB61173 20019578 A to G
FTB61174 20023712 G to C
FTB61175 20023805 C to A
FTB61176 20037063 T to C
FTB61177 20038256 A to C
FTB61178 20038799 T to G
FTB61179 20039885 A to G
FTB61180 20041576 G to A
FTB61181 20047480 G to A
FTB61182 20052705 G to T
FTB61183 20359142 G to T
FTB61184 20361437 C to T
FTB61185 20379184 G to T
FTB61186 20386428 G to C
FTB61187 20387631 A to G
FTB61188 20399081 T to C
FTB61189 20403796 G to A
FTB61190 20406111 G to C
FTB61191 20407811 G to T
FTB61192 20408243 G to A
FTB61193 20411216 G to A
FTB61194 20411410 C to A
FTB61195 20415991 A to C
FTB61196 20426478 C to T
FTB61197 20445364 C to T
FTB61198 20446548 A to C
FTB61199 20447778 C to T
FTB61200 20450975 G to A
FTB61201 20453897 G to C
FTB61202 20456509 A to T
FTB61203 20464594 G to A
FTB61204 20464815 G to A
FTB61205 20466775 T to C
FTB61206 20469899 G to T
FTB61207 20477453 G to A
FTB61208 20484458 G to A
FTB61209 20488103 C to G
FTB61210 20496835 T to C
FTB61211 20499212 T to C
FTB61212 20508972 C to T
FTB61213 20511591 A to C
FTB61214 20517551 T to C
FTB61215 20519196 C to T
FTB61216 20525192 A to G
FTB61217 20535740 C to G
FTB61218 20548317 T to C
FTB61219 20560581 C to T
FTB61220 20568024 T to C
FTB61221 20575627 T to C
FTB61222 20579317 T to G
FTB61223 20600339 T to A
FTB61224 20600589 A to G
FTB61225 20606400 G to C
FTB61226 20613594 C to T
FTB61227 20636868 A to C
FTB61228 20644188 T to C
FTB61229 20646432 G to A
FTB61230 20650095 T to C
FTB61231 20662317 C to T
FTB61232 20664392 G to A
FTB61233 20666781 C to T
FTB61234 20685796 C to A
FTB61235 20697602 A to T
FTB61236 20699140 A to T
FTB61237 20699944 G to A
FTB61238 20706949 A to C
FTB61239 20708164 T to C
FTB61240 20715011 T to G
FTB61241 20719591 T to G
FTB61242 20719869 T to C
FTB61243 20727098 C to T
FTB61244 20738656 G to T
FTB61245 20738863 T to C
FTB61246 20739396 T to C
FTB61247 20741151 T to G
FTB61248 20743343 C to T
FTB61249 20752705 C to T
FTB61250 20755768 A to T
FTB61251 20758245 G to C
FTB61252 20761181 A to G
FTB61253 20764822 A to C
FTB61254 20769662 C to T
FTB61255 20773648 G to A
FTB61256 20776538 T to G
FTB61257 20778900 A to G
FTB61258 20779285 G to T
FTB61259 20779287 C to A
FTB61260 20803974 T to C
FTB61261 20809282 T to C
FTB61262 20813705 A to G
FTB61263 20813826 C to A
FTB61264 20816763 C to A
FTB61265 20816770 A to T
FTB61266 20818974 C to G
FTB61267 20836147 T to C
FTB61268 20836897 A to G
FTB61269 20838537 C to T
FTB61270 20840798 A to T
FTB61271 20846869 C to G
FTB61272 20850271 C to T
FTB61273 20859093 C to T
FTB61274 20864132 A to C
FTB61275 20871595 C to A
FTB61276 20881553 T to C
FTB61277 20881705 C to T
FTB61278 20892104 G to T
FTB61279 20893502 T to C
FTB61280 20895137 G to A
FTB61281 20896987 G to A
FTB61282 20905058 C to G
FTB61283 20906150 C to A
FTB61284 20906411 A to C
FTB61285 20913596 T to C
FTB61286 20914045 G to A
FTB61287 20927166 G to T
FTB61288 20928254 G to C
FTB61289 20949958 G to T
FTB61290 20950592 C to T
FTB61291 20952187 A to G
FTB61292 20952865 T to C
FTB61293 20953759 G to A
FTB61294 20955554 G to A
FTB61295 20958544 C to T
FTB61296 20961445 G to A
FTB61297 20967001 A to T
FTB61298 20970525 G to A
FTB61299 20971466 A to G
FTB61300 20971472 T to G
FTB61301 20972341 G to T
FTB61302 20976474 G to A
FTB61303 20977478 C to A
FTB61304 20980634 G to T
FTB61305 20984971 A to T
FTB61306 20985280 C to G
FTB61307 20985394 C to T
FTB61308 20998880 C to A
FTB61309 21002301 C to T
FTB61310 21005599 C to T
FTB61311 21021890 G to T
FTB61312 21022520 T to C
FTB61313 21023623 G to C
FTB61314 21024708 C to G
FTB61315 21025305 T to C
FTB61316 21027110 T to C
FTB61317 21029607 G to A
FTB61318 21033907 A to G
FTB61319 21036770 C to A
FTB61320 21037684 T to A
FTB61321 21037686 T to G
FTB61322 21038018 C to G
FTB61323 21042817 G to A
FTB61324 21078973 T to C
FTB61325 21080242 T to C
FTB61326 21082505 A to G
FTB61327 21102407 C to T
FTB61328 21105551 A to G
FTB61329 21106667 T to C
FTB61330 21107266 G to A
FTB61331 21126290 G to A
FTB61332 21129000 C to G
FTB61333 21142408 C to G
FTB61334 21148753 C to T
FTB61335 21172119 G to A
FTB61336 21177709 T to C
FTB61337 21180903 A to C
FTB61338 21182560 T to C
FTB61339 21183566 C to T
FTB61340 21197222 T to G
FTB61341 21203991 T to C
FTB61342 21207297 T to A
FTB61343 21209769 T to C
FTB61344 21211678 T to G
FTB61345 21216663 T to G
FTB61346 21222263 T to C
FTB61347 21226270 A to C
FTB61348 21228910 T to C
FTB61349 21229507 A to T
FTB61350 21230865 G to A
FTB61351 21237292 A to C
FTB61352 21247328 A to C
FTB61353 21249395 A to C
FTB61354 21268667 A to G
FTB61355 21273845 C to G
FTB61356 21277797 C to T
FTB61357 21278026 T to G
FTB61358 21284811 T to C
FTB61359 21288399 G to A
FTB61360 21290620 G to C
FTB61361 21294881 C to G
FTB61362 21308436 C to T
FTB61363 21309467 G to A
FTB61364 21310467 C to A
FTB61365 21331001 A to C
FTB61366 21332646 G to C
FTB61367 21342332 T to C
FTB61368 21350459 A to G
FTB61369 21384499 C to T
FTB61370 21385251 G to A
FTB61371 21391240 G to T
FTB61372 21396639 G to A
FTB61373 21396672 A to T
FTB61374 21405413 C to A
FTB61375 21409332 G to T
FTB61376 21413615 A to T
FTB61377 21421488 A to T
FTB61378 21428625 T to A
FTB61379 21430765 T to C
FTB61380 21440181 C to A
FTB61381 21446601 T to C
FTB61382 21449091 G to T
FTB61383 21456336 T to C
FTB61384 21462734 C to T
FTB61385 21466702 C to T
FTB61386 21469978 C to T
FTB61387 21473629 T to C
FTB61388 21592868 A to G
FTB61389 21599397 C to G
FTB61390 21599522 T to G
FTB61391 21604643 C to A
FTB61392 21604867 C to A
FTB61393 21609470 C to T
FTB61394 21613836 C to T
FTB61395 21631983 A to C
FTB61396 21632354 C to A
FTB61397 21637320 C to G
FTB61398 21646051 T to G
FTB61399 21646275 A to C
FTB61400 21651257 G to A
FTB61401 21661509 A to T
FTB61402 21673988 T to C
FTB61403 21684697 G to T
FTB61404 21685830 A to T
FTB61405 21687139 A to G
FTB61406 21698756 T to C
FTB61407 21710536 G to T
FTB61408 21713026 C to T
FTB61409 21819034 A to G
FTB61410 21825216 C to T
FTB61411 21831522 A to G
FTB61412 21831684 A to G
FTB61413 21831946 G to A
FTB61414 21843579 C to T
FTB61415 22234956 G to C
FTB61416 22249958 G to T
FTB61417 22262846 C to G
FTB61418 22266441 C to T
FTB61419 22267488 G to C
FTB61420 22268630 A to T
FTB61421 22278417 G to C
FTB61422 22289458 A to G
FTB61423 22300636 C to T
FTB61424 22302063 A to C
FTB61425 22307337 G to A
FTB61426 22310552 T to C
FTB61427 22322095 A to G
FTB61428 22326649 C to T
FTB61429 26314294 C to A
FTB61430 26324628 C to G
FTB61431 26325077 T to C
FTB61432 26331578 C to T
FTB61433 26332265 T to G
FTB61434 26332453 T to C
FTB61435 26333453 A to C
FTB61436 26349938 A to G
FTB61437 26355951 C to T
FTB61438 26357380 T to A
FTB61439 26358579 T to C
FTB61440 26368973 C to T
FTB61441 26369719 A to G
FTB61442 26370632 C to T
FTB61443 26371225 G to A
FTB61444 26372412 T to G
FTB61445 26372960 T to G
FTB61446 26378182 A to C
FTB61447 26384387 T to C
FTB61448 26388325 G to A
FTB61449 26389989 C to T
FTB61450 26394058 C to G
FTB61451 26400602 G to T
FTB61452 26406783 A to G
FTB61453 26412003 T to A
FTB61454 26414748 T to A
FTB61455 26417677 A to G
FTB61456 26428072 T to C
FTB61457 26431407 A to G
FTB61458 26445602 C to T
FTB61459 26447796 G to C
FTB61460 26449858 C to G
FTB61461 26454339 C to G
FTB61462 26454638 G to A
FTB61463 26455508 G to C
FTB61464 26457462 T to C
FTB61465 26466914 A to G
FTB61466 26468929 A to T
FTB61467 26472624 A to T
FTB61468 26472902 G to T
FTB61469 26474750 T to G
FTB61470 26477333 A to T
FTB61471 26482013 C to G
FTB61472 26488528 T to C
FTB61473 26489372 A to G
FTB61474 26489556 T to C
FTB61475 26490944 A to G
FTB61476 26493645 C to T
FTB61477 26494945 T to C
FTB61478 26496059 C to A
FTB61479 26498883 A to G
FTB61480 26500422 T to C
FTB61481 26501872 C to T
FTB61482 26501903 T to C
FTB61483 26509704 G to A
FTB61484 26512008 G to C
FTB61485 26512478 G to A
FTB61486 26522511 A to T
FTB61487 26523592 G to A
FTB61488 26542558 C to T
FTB61489 26546128 C to T
FTB61490 26565016 T to G
FTB61491 26566902 T to C
FTB61492 26581245 T to A
FTB61493 26581450 A to C
FTB61494 26582035 C to T
FTB61495 26586199 T to C
FTB61496 26588803 C to T
FTB61497 26589427 A to C
FTB61498 26591842 G to T
FTB61499 26596012 T to C
FTB61500 26597547 C to T
FTB61501 26598325 C to G
FTB61502 26608124 A to G
FTB61503 26612890 G to C
FTB61504 26616602 A to T
FTB61505 26617960 T to G
FTB61506 26619257 C to T
FTB61507 26619402 A to G
FTB61508 26622008 C to G
FTB61509 19309522 T to A
FTB61510 2781741 G to T
FTB61511 3058084 C to T
FTB61512 3073482 G to T
FTB61513 3096463 T to C
FTB61514 3100964 C to T
FTB61515 3106347 A to T
FTB61516 3120274 G to T
FTB61517 3162110 C to T
FTB61518 3166224 C to T
FTB61519 3207437 G to C
FTB61520 3207644 G to C
FTB61521 3208621 A to C
FTB61522 3210412 G to C
FTB61523 3214537 C to T
FTB61524 3228306 G to T
FTB61525 3242187 C to G
FTB61526 3280504 T to A
FTB61527 3282910 C to T
FTB61528 3352542 A to G
FTB61529 3372751 T to A
FTB61530 3372767 G to A
FTB61531 3388157 C to T
FTB61532 3401818 A to G
FTB61533 3411573 G to A
FTB61534 3433521 T to G
FTB61535 3436661 A to T
FTB61536 3438547 T to A
FTB61537 3460751 T to C
FTB61538 3487767 C to T
FTB61539 3505633 T to C
FTB61540 3506977 G to C
FTB61541 3562659 T to C
FTB61542 3564721 G to A
FTB61543 3572596 T to C
FTB61544 3576086 C to T
FTB61545 3595519 C to T
FTB61546 3618998 T to C
FTB61547 3627409 A to T
FTB61548 3676412 A to G
FTB61549 3681268 A to G
FTB61550 3687579 G to A
FTB61551 3705138 T to C
FTB61552 3712549 C to T
FTB61553 3735223 C to T
FTB61554 3778396 C to T
FTB61555 3786399 C to T
FTB61556 3818917 G to T
FTB61557 3819264 A to C
FTB61558 3844205 C to T
FTB61559 3857534 G to A
FTB61560 3917906 G to A
FTB61561 3925208 A to G
FTB61562 3973348 G to T
FTB61563 3980028 T to C
FTB61564 3998888 G to A
FTB61565 4049605 C to T
FTB61566 4057377 T to C
FTB61567 4058202 T to C
FTB61568 4067625 A to G
FTB61569 4079645 G to C
FTB61570 4081471 G to C
FTB61571 4104281 T to C
FTB61572 4112428 T to A
FTB61573 4136068 A to C
FTB61574 4138213 T to C
FTB61575 4143020 T to G
FTB61576 4150980 A to G
FTB61577 4152196 A to G
FTB61578 4179474 C to A
FTB61579 4182701 G to T
FTB61580 4188508 T to C
FTB61581 4188974 G to C
FTB61582 4196708 T to A
FTB61583 4199114 A to G
FTB61584 4235318 G to C
FTB61585 4246863 C to G
FTB61586 4248622 T to G
FTB61587 4261246 C to A
FTB61588 4269839 C to A
FTB61589 4272088 A to G
FTB61590 4279741 C to A
FTB61591 4287060 G to T
FTB61592 4302348 G to A
FTB61593 4311483 T to G
FTB61594 4344408 A to G
FTB61595 4347828 T to C
FTB61596 4361656 A to G
FTB61597 4364206 A to T
FTB61598 4365778 T to A
FTB61599 4381774 C to G
FTB61600 4384737 T to A
FTB61601 4390136 G to A
FTB61602 4396675 C to A
FTB61603 4403248 A to G
FTB61604 4428376 A to G
FTB61605 4432242 G to A
FTB61606 4438759 G to A
FTB61607 4443960 T to C
FTB61608 4463245 T to C
FTB61609 4476994 C to T
FTB61610 4479300 C to T
FTB61611 4502520 C to G
FTB61612 4502662 G to C
FTB61613 4572497 T to C
FTB61614 4598473 A to T
FTB61615 4606802 T to C
FTB61616 4639868 A to T
FTB61617 4675658 A to T
FTB61618 4684127 T to C
FTB61619 4698727 T to G
FTB61620 4702298 C to G
FTB61621 4702843 G to T
FTB61622 4706023 T to C
FTB61623 4717346 G to A
FTB61624 4724716 T to G
FTB61625 4735556 A to C
FTB61626 4736744 T to C
FTB61627 4784633 A to C
FTB61628 4785945 G to A
FTB61629 4832319 G to A
FTB61630 4837171 T to C
FTB61631 4848374 G to A
FTB61632 4849491 T to C
FTB61633 4850404 T to C
FTB61634 4874689 A to T
FTB61635 4894122 C to A
FTB61636 4933573 G to A
FTB61637 4947086 T to A
FTB61638 4948773 G to T
FTB61639 4979943 T to G
FTB61640 4985980 G to A
FTB61641 5015074 A to C
FTB61642 5021307 C to G
FTB61643 5027392 C to G
FTB61644 5034446 C to G
FTB61645 5054371 C to T
FTB61646 5062908 G to A
FTB61647 5067882 G to A
FTB61648 5072216 T to C
FTB61649 5081251 C to A
FTB61650 5088149 T to C
FTB61651 5089033 A to C
FTB61652 5102586 T to A
FTB61653 5107210 A to G
FTB61654 5115306 G to A
FTB61655 5116403 T to C
FTB61656 5117983 A to G
FTB61657 5148973 A to G
FTB61658 5173483 G to A
FTB61659 5207773 G to A
FTB61660 5224221 C to G
FTB61661 5239967 A to G
FTB61662 5243247 C to G
FTB61663 5251912 A to C
FTB61664 5254626 G to A
FTB61665 5267363 C to A
FTB61666 5288028 T to A
FTB61667 5299027 A to G
FTB61668 5316867 T to C
FTB61669 5323055 T to C
FTB61670 5332420 A to T
FTB61671 5347430 G to A
FTB61672 5352285 C to T
FTB61673 5361132 T to G
FTB61674 5376364 C to T
FTB61675 5376372 C to G
FTB61676 5383585 A to G
FTB61677 5384504 A to C
FTB61678 5386226 G to A
FTB61679 5386477 T to G
FTB61680 5399859 T to C
FTB61681 5401276 C to T
FTB61682 5414888 C to T
FTB61683 5424434 C to A
FTB61684 5429581 T to C
FTB61685 5470050 T to G
FTB61686 5487574 A to T
FTB61687 5511951 A to G
FTB61688 5527271 A to G
FTB61689 5532874 C to T
FTB61690 5532892 C to A
FTB61691 5542981 C to G
FTB61692 5550864 A to G
FTB61693 5592953 T to A
FTB61694 5603097 T to C
FTB61695 5603277 G to C
FTB61696 5625443 T to C
FTB61697 5632086 C to T
FTB61698 5677760 C to T
FTB61699 5678101 G to T
FTB61700 5711050 C to T
FTB61701 5714421 C to T
FTB61702 5724380 C to T
FTB61703 5737780 G to C
FTB61704 5762455 C to T
FTB61705 5765526 A to G
FTB61706 5798241 G to A
FTB61707 5826928 C to T
FTB61708 5909065 C to T
FTB61709 5930918 A to G
FTB61710 5951348 C to G
FTB61711 5967270 T to C
FTB61712 5969766 T to C
FTB61713 5978414 T to A
FTB61714 5997055 A to G
FTB61715 5998540 A to G
FTB61716 6003009 G to A
FTB61717 6071082 T to C
FTB61718 6092316 G to A
FTB61719 6101593 C to A
FTB61720 6114452 G to T
FTB61721 6128683 G to A
FTB61722 6131412 C to T
FTB61723 6132188 C to T
FTB61724 6133336 G to A
FTB61725 6152114 T to C
FTB61726 6158459 A to C
FTB61727 6196485 C to A
FTB61728 6219660 T to C
FTB61729 6229585 G to A
FTB61730 6281561 T to C
FTB61731 6322076 A to G
FTB61732 6326382 T to C
FTB61733 6339581 G to A
FTB61734 6363062 C to A
FTB61735 6483907 C to T
FTB61736 6485867 C to A
FTB61737 6534917 T to C
FTB61738 6535828 T to G
FTB61739 6540584 C to T
FTB61740 6544753 C to G
FTB61741 6553731 C to G
FTB61742 6559723 C to A
FTB61743 6585617 C to T
FTB61744 6599216 T to G
FTB61745 6602935 C to A
FTB61746 6641025 T to G
FTB61747 6691059 T to C
FTB61748 6710482 T to G
FTB61749 6712783 C to A
FTB61750 6732553 G to A
FTB61751 7303943 G to T
FTB61752 9542471 C to T
FTB61753 9551948 A to G
FTB61754 9628242 A to C
FTB61755 9630060 T to C
FTB61756 9662894 G to A
FTB61757 9665996 G to T
FTB61758 9680555 A to G
FTB61759 9686868 C to G
FTB61760 9790525 C to A
FTB61761 9949902 G to A
FTB61762 9950695 C to T
FTB61763 9950791 T to C
FTB61764 10067855 A to G
FTB61765 10069877 G to C
FTB61766 11700531 C to A
FTB61767 11702105 T to C
FTB61768 11703950 G to A
FTB61769 11706699 A to G
FTB61770 11709894 G to C
FTB61771 11710378 G to T
FTB61772 11710384 G to A
FTB61773 15883571 C to G
FTB61774 15894867 C to T
FTB61775 16177959 G to A
FTB61776 16368369 A to C
FTB61777 19263477 T to C
FTB61778 19389961 A to G
FTB61779 21493197 A to G
FTB61780 21580671 A to G
FTB61781 21811074 G to A
FTB61782 21848601 C to T
FTB61783 21854885 G to A
FTB61784 21862077 C to G
FTB61785 22339185 G to T
FTB61786 22364240 C to T
FTB61787 22368738 T to C
FTB61788 3174792 C to T
FTB61789 13776410 C to T
FTB61790 10842292 T to C
FTB61791 3460010 G to T
FTB61792 5117830 T to C
FTB61793 10845876 C to T
FTB61794 11671674 A to C
FTB61795 15657929 CCT to C
FTB61796 8175358 G to A
FTB61797 6118152 TTGCCATTAAAGATGCCCTTAAAAAT to T
FTB61798 6739255 T to C
FTB61799 10811746 C to T
FTB61800 11446177 A to G
FTB61801 8939136 C to T
FTB61802 2787163 T to C
FTB61803 2895523 C to T
FTB61804 2955202 T to C
FTB61805 2997414 C to T
FTB61806 3020743 T to G
FTB61807 3058532 G to A
FTB61808 3082065 A to G
FTB61809 3089105 G to A
FTB61810 3095852 A to G
FTB61811 3098329 G to A
FTB61812 3099000 G to A
FTB61813 3104843 A to G
FTB61814 3111644 C to T
FTB61815 3111645 A to G
FTB61816 3111646 C to T
FTB61817 3111647 C to A
FTB61818 3111776 G to C
FTB61819 3116045 C to A
FTB61820 3120152 C to T
FTB61821 3122695 G to C
FTB61822 3126299 T to A
FTB61823 3154638 G to T
FTB61824 3157633 A to C
FTB61825 3172447 A to G
FTB61826 3195591 G to T
FTB61827 3210270 G to A
FTB61828 3210457 T to A
FTB61829 3222681 C to T
FTB61830 3226048 C to T
FTB61831 3226717 A to G
FTB61832 3231912 A to T
FTB61833 3240951 C to G
FTB61834 3249980 T to A
FTB61835 3259772 C to T
FTB61836 3279473 G to A
FTB61837 3279585 C to G
FTB61838 3282360 C to T
FTB61839 3297019 G to C
FTB61840 3325529 T to C
FTB61841 3327625 A to T
FTB61842 3335443 G to A
FTB61843 3345350 A to G
FTB61844 3355725 A to G
FTB61845 3372681 A to G
FTB61846 3372889 G to C
FTB61847 3379739 G to A
FTB61848 3385796 A to T
FTB61849 3385925 T to G
FTB61850 3392943 G to T
FTB61851 3393853 A to G
FTB61852 3396189 C to T
FTB61853 3406239 A to G
FTB61854 3407615 C to A
FTB61855 3423311 G to A
FTB61856 3425743 A to C
FTB61857 3428872 C to G
FTB61858 3432318 A to G
FTB61859 3433540 T to C
FTB61860 3435646 G to T
FTB61861 3443352 G to A
FTB61862 3461181 A to G
FTB61863 3464776 T to G
FTB61864 3467709 G to A
FTB61865 3474772 A to G
FTB61866 3481185 T to C
FTB61867 3493250 T to C
FTB61868 3495120 T to C
FTB61869 3496526 A to G
FTB61870 3506717 G to A
FTB61871 3511588 G to A
FTB61872 3515574 C to T
FTB61873 3516074 C to A
FTB61874 3540660 G to A
FTB61875 3547237 G to A
FTB61876 3552409 T to C
FTB61877 3555024 T to C
FTB61878 3557141 C to A
FTB61879 3570969 G to A
FTB61880 3577140 G to C
FTB61881 3577371 A to G
FTB61882 3577991 G to C
FTB61883 3579976 A to G
FTB61884 3584450 C to T
FTB61885 3599355 T to G
FTB61886 3604202 A to C
FTB61887 3619869 C to G
FTB61888 3621096 C to A
FTB61889 3621100 C to G
FTB61890 3624563 T to C
FTB61891 3625167 T to C
FTB61892 3637156 G to T
FTB61893 3637684 G to A
FTB61894 3646701 G to C
FTB61895 3663866 A to T
FTB61896 3665870 T to C
FTB61897 3675374 C to T
FTB61898 3682397 C to T
FTB61899 3685219 A to T
FTB61900 3691798 T to C
FTB61901 3694896 A to T
FTB61902 3695530 G to T
FTB61903 3696082 T to C
FTB61904 3696565 G to C
FTB61905 3698634 T to G
FTB61906 3708395 G to A
FTB61907 3711050 G to A
FTB61908 3729285 C to T
FTB61909 3729839 C to T
FTB61910 3733822 C to T
FTB61911 3743220 G to A
FTB61912 3751144 C to T
FTB61913 3755324 G to T
FTB61914 3758908 T to C
FTB61915 3769444 G to A
FTB61916 3775552 A to G
FTB61917 3775709 T to C
FTB61918 3791746 T to C
FTB61919 3815648 A to G
FTB61920 3815660 G to A
FTB61921 3817531 A to C
FTB61922 3818369 A to C
FTB61923 3818433 T to A
FTB61924 3822648 G to T
FTB61925 3839645 T to C
FTB61926 3854178 G to A
FTB61927 3858580 C to A
FTB61928 3859216 T to C
FTB61929 3862296 G to T
FTB61930 3864366 C to A
FTB61931 3870578 C to T
FTB61932 3872909 T to C
FTB61933 3875232 C to T
FTB61934 3881615 A to G
FTB61935 3904821 A to T
FTB61936 3904822 C to A
FTB61937 3907279 C to A
FTB61938 3908337 C to T
FTB61939 3909701 T to C
FTB61940 3910277 A to T
FTB61941 3912960 C to T
FTB61942 3914786 T to C
FTB61943 3922636 A to G
FTB61944 3935105 G to A
FTB61945 3940415 G to T
FTB61946 3945002 T to A
FTB61947 3946532 G to A
FTB61948 3947927 G to A
FTB61949 3949542 T to C
FTB61950 3950561 G to C
FTB61951 3952484 A to G
FTB61952 3956985 A to G
FTB61953 3970305 T to G
FTB61954 3970938 G to A
FTB61955 3973797 C to A
FTB61956 3976337 T to C
FTB61957 3980624 A to G
FTB61958 3983799 T to C
FTB61959 3984105 G to A
FTB61960 3995600 C to T
FTB61961 4000830 A to G
FTB61962 4005701 T to A
FTB61963 4027337 T to C
FTB61964 4029127 G to A
FTB61965 4030472 T to C
FTB61966 4031224 C to G
FTB61967 4048487 T to C
FTB61968 4054262 C to T
FTB61969 4064876 C to A
FTB61970 4079068 C to T
FTB61971 4079459 G to A
FTB61972 4089592 T to A
FTB61973 4090560 T to C
FTB61974 4091077 A to G
FTB61975 4093985 A to C
FTB61976 4102547 T to C
FTB61977 4104714 G to A
FTB61978 4106887 T to C
FTB61979 4109032 C to T
FTB61980 4114695 G to A
FTB61981 4115679 A to G
FTB61982 4118336 G to A
FTB61983 4118570 A to G
FTB61984 4119498 A to C
FTB61985 4136349 T to C
FTB61986 4144676 T to C
FTB61987 4147417 A to G
FTB61988 4163706 C to T
FTB61989 4166992 T to C
FTB61990 4168690 T to C
FTB61991 4183162 A to T
FTB61992 4183642 C to G
FTB61993 4187695 C to A
FTB61994 4206741 C to T
FTB61995 4224382 C to A
FTB61996 4237425 A to T
FTB61997 4247716 C to T
FTB61998 4266292 T to A
FTB61999 4272160 A to C
FTB62000 4272554 T to C
FTB62001 4277366 G to A
FTB62002 4279543 A to T
FTB62003 4279751 T to G
FTB62004 4280878 A to T
FTB62005 4284333 C to T
FTB62006 4286285 G to T
FTB62007 4290479 A to G
FTB62008 4298629 G to A
FTB62009 4304598 T to C
FTB62010 4306912 T to C
FTB62011 4308599 G to T
FTB62012 4311628 C to G
FTB62013 4316052 G to T
FTB62014 4318536 G to T
FTB62015 4321642 A to C
FTB62016 4327455 A to G
FTB62017 4332361 A to G
FTB62018 4366599 A to T
FTB62019 4366832 T to C
FTB62020 4372411 C to T
FTB62021 4377833 G to A
FTB62022 4380402 T to G
FTB62023 4381773 A to G
FTB62024 4394334 A to T
FTB62025 4395127 A to G
FTB62026 4398861 T to C
FTB62027 4403401 A to G
FTB62028 4408640 A to G
FTB62029 4418542 C to G
FTB62030 4427445 C to T
FTB62031 4435030 T to A
FTB62032 4439273 C to T
FTB62033 4443068 A to T
FTB62034 4454480 G to T
FTB62035 4454721 A to G
FTB62036 4461513 C to G
FTB62037 4466643 C to G
FTB62038 4466696 C to G
FTB62039 4472356 A to T
FTB62040 4475881 C to T
FTB62041 4477098 G to A
FTB62042 4477192 C to T
FTB62043 4488525 G to T
FTB62044 4496804 T to A
FTB62045 4498879 A to G
FTB62046 4499728 C to T
FTB62047 4508791 C to T
FTB62048 4511984 T to A
FTB62049 4512852 A to T
FTB62050 4516111 A to G
FTB62051 4520198 G to T
FTB62052 4526236 G to C
FTB62053 4532115 T to C
FTB62054 4543171 A to C
FTB62055 4567193 A to C
FTB62056 4572517 T to C
FTB62057 4576414 G to A
FTB62058 4577974 A to T
FTB62059 4582459 G to T
FTB62060 4589873 G to A
FTB62061 4600680 T to C
FTB62062 4602766 T to C
FTB62063 4605125 A to G
FTB62064 4605478 A to G
FTB62065 4621979 C to G
FTB62066 4628946 A to G
FTB62067 4629070 T to C
FTB62068 4637730 C to A
FTB62069 4640577 G to C
FTB62070 4641940 G to A
FTB62071 4642275 A to G
FTB62072 4642866 T to A
FTB62073 4642888 C to T
FTB62074 4648449 C to G
FTB62075 4663323 G to T
FTB62076 4668996 T to C
FTB62077 4673515 A to T
FTB62078 4676478 G to A
FTB62079 4677164 A to G
FTB62080 4683151 C to G
FTB62081 4691574 C to G
FTB62082 4692374 A to C
FTB62083 4692375 A to T
FTB62084 4719166 A to C
FTB62085 4730037 G to A
FTB62086 4731771 C to G
FTB62087 4733134 T to C
FTB62088 4746851 G to A
FTB62089 4787558 C to T
FTB62090 4794093 C to G
FTB62091 4798879 A to T
FTB62092 4798880 A to T
FTB62093 4804774 T to C
FTB62094 4808024 A to T
FTB62095 4810110 T to C
FTB62096 4811136 G to A
FTB62097 4822221 T to C
FTB62098 4827166 C to T
FTB62099 4835877 C to A
FTB62100 4841560 C to G
FTB62101 4841642 C to T
FTB62102 4841825 T to A
FTB62103 4856396 G to T
FTB62104 4866040 G to A
FTB62105 4874560 C to G
FTB62106 4880035 C to T
FTB62107 4886654 A to C
FTB62108 4891912 G to A
FTB62109 4900499 G to T
FTB62110 4909266 G to C
FTB62111 4910124 C to T
FTB62112 4926534 G to C
FTB62113 4927617 C to A
FTB62114 4932541 C to T
FTB62115 4938373 G to A
FTB62116 4938805 C to T
FTB62117 4943875 C to G
FTB62118 4944671 G to A
FTB62119 4948960 T to C
FTB62120 4957054 G to A
FTB62121 4963925 A to G
FTB62122 4967235 G to A
FTB62123 4981028 C to T
FTB62124 4986002 C to G
FTB62125 4998346 C to T
FTB62126 5000268 A to T
FTB62127 5000804 C to T
FTB62128 5001311 T to C
FTB62129 5003183 C to T
FTB62130 5007239 A to G
FTB62131 5010163 C to T
FTB62132 5013355 T to C
FTB62133 5020546 A to G
FTB62134 5022652 A to G
FTB62135 5032127 A to G
FTB62136 5034784 G to T
FTB62137 5038137 G to A
FTB62138 5061757 G to A
FTB62139 5063127 C to G
FTB62140 5066611 G to T
FTB62141 5069400 C to G
FTB62142 5070663 G to T
FTB62143 5071121 G to C
FTB62144 5086464 G to C
FTB62145 5099211 T to G
FTB62146 5100469 G to A
FTB62147 5107487 A to C
FTB62148 5107788 G to A
FTB62149 5108015 C to T
FTB62150 5108499 G to C
FTB62151 5115080 A to G
FTB62152 5130742 C to T
FTB62153 5145165 A to G
FTB62154 5149695 C to G
FTB62155 5155513 C to T
FTB62156 5158261 C to A
FTB62157 5161593 G to T
FTB62158 5178217 T to G
FTB62159 5183249 C to T
FTB62160 5183901 G to A
FTB62161 5201035 T to C
FTB62162 5207756 G to C
FTB62163 5214010 C to T
FTB62164 5216319 C to A
FTB62165 5227178 A to G
FTB62166 5229755 C to A
FTB62167 5243083 C to G
FTB62168 5243301 A to G
FTB62169 5248229 A to T
FTB62170 5266957 G to C
FTB62171 5266980 A to T
FTB62172 5275075 G to A
FTB62173 5277812 G to A
FTB62174 5293275 G to A
FTB62175 5295635 C to T
FTB62176 5310892 T to C
FTB62177 5315924 T to A
FTB62178 5319276 G to T
FTB62179 5341341 C to T
FTB62180 5341905 G to A
FTB62181 5351215 A to T
FTB62182 5352344 G to C
FTB62183 5358784 C to G
FTB62184 5371254 G to A
FTB62185 5375752 G to T
FTB62186 5377618 A to T
FTB62187 5401739 C to T
FTB62188 5406672 C to T
FTB62189 5408655 G to A
FTB62190 5418794 G to C
FTB62191 5419186 T to C
FTB62192 5428739 C to A
FTB62193 5430531 C to A
FTB62194 5435106 T to C
FTB62195 5446095 C to A
FTB62196 5448273 A to T
FTB62197 5448501 A to G
FTB62198 5451536 G to A
FTB62199 5460501 C to T
FTB62200 5465354 T to C
FTB62201 5471678 A to T
FTB62202 5482787 A to G
FTB62203 5485739 A to T
FTB62204 5494369 C to T
FTB62205 5503904 C to T
FTB62206 5511787 A to G
FTB62207 5516666 G to A
FTB62208 5516667 A to T
FTB62209 5517988 G to C
FTB62210 5522754 C to T
FTB62211 5526010 C to T
FTB62212 5526364 C to T
FTB62213 5527264 T to A
FTB62214 5541635 G to T
FTB62215 5542733 A to G
FTB62216 5543190 T to C
FTB62217 5551357 A to G
FTB62218 5573469 G to A
FTB62219 5580125 A to G
FTB62220 5589904 A to G
FTB62221 5595551 T to C
FTB62222 5614681 C to T
FTB62223 5624853 T to C
FTB62224 5626117 C to G
FTB62225 5626218 G to T
FTB62226 5626524 C to G
FTB62227 5626694 C to G
FTB62228 5626757 C to G
FTB62229 5631663 G to A
FTB62230 5688521 A to T
FTB62231 5695629 C to G
FTB62232 5697770 C to T
FTB62233 5707033 G to A
FTB62234 5727228 A to T
FTB62235 5729645 T to C
FTB62236 5731236 A to G
FTB62237 5744359 G to A
FTB62238 5744866 C to T
FTB62239 5747644 C to T
FTB62240 5754338 A to G
FTB62241 5754357 T to C
FTB62242 5766544 C to T
FTB62243 5766561 C to A
FTB62244 5780834 T to C
FTB62245 5784059 C to G
FTB62246 5786480 A to T
FTB62247 5793386 T to C
FTB62248 5802345 A to T
FTB62249 5805813 A to G
FTB62250 5805890 T to C
FTB62251 5816667 G to A
FTB62252 5816970 C to T
FTB62253 5820944 A to T
FTB62254 5821847 C to T
FTB62255 5823941 G to T
FTB62256 5826399 A to T
FTB62257 5832100 G to A
FTB62258 5832277 T to C
FTB62259 5854522 C to A
FTB62260 5874260 C to T
FTB62261 5882874 T to C
FTB62262 5882949 T to G
FTB62263 5883960 G to C
FTB62264 5896702 A to G
FTB62265 5902125 C to T
FTB62266 5908966 G to T
FTB62267 5913071 G to A
FTB62268 5918680 C to T
FTB62269 5919800 C to T
FTB62270 5920284 G to A
FTB62271 5937665 C to T
FTB62272 5937690 G to C
FTB62273 5957018 A to C
FTB62274 5960755 C to G
FTB62275 5965704 C to G
FTB62276 5981560 T to C
FTB62277 5985243 T to C
FTB62278 6006532 C to T
FTB62279 6006543 A to T
FTB62280 6015032 A to T
FTB62281 6020408 C to A
FTB62282 6030302 T to C
FTB62283 6033007 C to T
FTB62284 6055047 C to T
FTB62285 6055099 T to A
FTB62286 6070141 A to G
FTB62287 6076751 G to C
FTB62288 6090808 A to C
FTB62289 6102275 T to G
FTB62290 6106057 G to C
FTB62291 6108149 A to C
FTB62292 6114514 T to C
FTB62293 6121624 A to C
FTB62294 6128046 G to C
FTB62295 6130347 G to T
FTB62296 6154099 C to T
FTB62297 6154159 T to C
FTB62298 6155046 C to T
FTB62299 6159481 C to A
FTB62300 6173659 A to T
FTB62301 6175622 C to T
FTB62302 6183131 T to G
FTB62303 6196182 A to G
FTB62304 6198570 G to A
FTB62305 6199411 A to G
FTB62306 6202408 T to C
FTB62307 6204549 C to T
FTB62308 6208363 G to T
FTB62309 6210193 A to G
FTB62310 6218557 G to A
FTB62311 6226248 G to A
FTB62312 6233487 A to G
FTB62313 6234675 G to C
FTB62314 6267174 A to C
FTB62315 6270309 A to G
FTB62316 6270802 C to G
FTB62317 6411276 T to C
FTB62318 6457828 C to T
FTB62319 6481130 C to T
FTB62320 6482590 T to C
FTB62321 6483581 C to T
FTB62322 6484630 C to A
FTB62323 6491928 G to T
FTB62324 6498869 A to G
FTB62325 6500597 T to G
FTB62326 6504449 G to A
FTB62327 6511083 A to C
FTB62328 6514184 C to T
FTB62329 6520184 A to C
FTB62330 6521198 C to T
FTB62331 6527220 G to A
FTB62332 6537875 A to G
FTB62333 6537988 C to T
FTB62334 6546424 T to C
FTB62335 6548975 A to G
FTB62336 6563644 C to G
FTB62337 6568359 G to A
FTB62338 6574434 C to T
FTB62339 6586045 A to G
FTB62340 6592146 T to A
FTB62341 6592409 C to G
FTB62342 6605702 T to C
FTB62343 6618924 G to T
FTB62344 6619682 T to C
FTB62345 6620172 C to T
FTB62346 6638317 C to T
FTB62347 6638905 G to A
FTB62348 6655859 G to C
FTB62349 6665890 T to C
FTB62350 6665891 G to T
FTB62351 6667060 G to A
FTB62352 6675191 G to A
FTB62353 6710889 G to C
FTB62354 6711318 T to C
FTB62355 6711926 G to C
FTB62356 6714575 G to T
FTB62357 6714720 A to G
FTB62358 6715652 T to G
FTB62359 6717582 A to T
FTB62360 6718616 A to T
FTB62361 6721384 T to C
FTB62362 6763879 A to T
FTB62363 6798553 T to C
FTB62364 7144262 C to T
FTB62365 7145298 G to T
FTB62366 7213466 A to C
FTB62367 7213467 T to C
FTB62368 7213469 A to C
FTB62369 7213476 A to G
FTB62370 7245391 G to C
FTB62371 7342787 A to C
FTB62372 7451341 C to T
FTB62373 7741290 A to G
FTB62374 7891071 A to G
FTB62375 8053399 T to C
FTB62376 8077753 A to G
FTB62377 8371687 C to A
FTB62378 8749464 A to G
FTB62379 8818001 T to C
FTB62380 8982794 G to A
FTB62381 8991592 A to G
FTB62382 9043749 C to A
FTB62383 9109528 T to G
FTB62384 9236085 A to G
FTB62385 9579816 T to A
FTB62386 9627354 T to G
FTB62387 9627945 C to T
FTB62388 9631612 T to A
FTB62389 9633877 C to T
FTB62390 9654525 T to A
FTB62391 9658652 T to G
FTB62392 9671880 T to C
FTB62393 9674167 G to C
FTB62394 9674219 G to A
FTB62395 9684532 C to A
FTB62396 9739105 G to T
FTB62397 9810506 G to A
FTB62398 9837045 A to G
FTB62399 9852594 G to T
FTB62400 9901597 C to T
FTB62401 9906674 G to A
FTB62402 9917376 G to A
FTB62403 9935809 C to T
FTB62404 9937363 G to A
FTB62405 9955839 T to A
FTB62406 9958713 T to C
FTB62407 9968108 A to C
FTB62408 9981090 G to A
FTB62409 10063310 A to G
FTB62410 11693679 T to A
FTB62411 11693680 T to G
FTB62412 11695173 G to A
FTB62413 11695233 G to A
FTB62414 11696393 T to C
FTB62415 11699466 A to G
FTB62416 11705789 G to A
FTB62417 11709308 C to A
FTB62418 11710159 A to C
FTB62419 11719701 A to C
FTB62420 11729870 G to T
FTB62421 11731742 A to G
FTB62422 11732554 G to A
FTB62423 11732589 C to A
FTB62424 11732775 A to T
FTB62425 11738823 G to A
FTB62426 11747234 C to G
FTB62427 11748785 A to C
FTB62428 11869322 T to G
FTB62429 11906978 C to T
FTB62430 11930899 A to G
FTB62431 11956777 G to T
FTB62432 12023481 G to A
FTB62433 12252188 A to C
FTB62434 12255143 G to C
FTB62435 12316603 T to C
FTB62436 12364007 G to C
FTB62437 12375065 C to G
FTB62438 12381357 A to G
FTB62439 12401853 A to T
FTB62440 12551648 G to A
FTB62441 12556267 G to T
FTB62442 12595714 T to G
FTB62443 12652388 T to C
FTB62444 12742694 A to G
FTB62445 12798035 C to T
FTB62446 12798037 C to G
FTB62447 12892463 A to G
FTB62448 12905141 C to T
FTB62449 12946097 C to G
FTB62450 13052194 G to A
FTB62451 13053350 A to G
FTB62452 13152982 G to A
FTB62453 13457377 T to C
FTB62454 14117886 C to G
FTB62455 14188384 T to C
FTB62456 14198906 C to G
FTB62457 14212502 T to C
FTB62458 14238559 T to A
FTB62459 14277588 T to G
FTB62460 14314568 C to T
FTB62461 14374868 A to T
FTB62462 14453676 A to G
FTB62463 14460197 T to A
FTB62464 14492552 T to C
FTB62465 14533747 C to G
FTB62466 14739326 G to C
FTB62467 14843143 C to T
FTB62468 15197307 G to A
FTB62469 15285500 G to C
FTB62470 15285925 G to T
FTB62471 15336219 C to A
FTB62472 15445370 A to G
FTB62473 15459874 A to T
FTB62474 15479250 T to A
FTB62475 15605926 A to C
FTB62476 15838182 A to C
FTB62477 15866234 C to T
FTB62478 15876675 A to T
FTB62479 15894947 G to A
FTB62480 16039129 C to T
FTB62481 16144003 C to A
FTB62482 16159648 C to T
FTB62483 16408692 A to G
FTB62484 16410549 C to T
FTB62485 16425601 C to T
FTB62486 16440677 T to G
FTB62487 16553055 A to G
FTB62488 16880062 T to C
FTB62489 16976713 G to A
FTB62490 16982955 A to T
FTB62491 17066926 C to A
FTB62492 17310946 C to A
FTB62493 17418693 T to C
FTB62494 17426373 T to C
FTB62495 18937553 C to A
FTB62496 19252233 G to T
FTB62497 19318340 C to T
FTB62498 19520387 C to T
FTB62499 19529145 G to A
FTB62500 19634060 T to G
FTB62501 19634562 G to A
FTB62502 19676255 A to G
FTB62503 19691299 C to T
FTB62504 19753258 C to T
FTB62505 19871911 A to G
FTB62506 20015164 A to T
FTB62507 20044628 A to G
FTB62508 20351127 C to T
FTB62509 20406837 C to T
FTB62510 20561293 C to G
FTB62511 20591231 T to C
FTB62512 20600801 A to G
FTB62513 20817108 A to C
FTB62514 20903824 T to A
FTB62515 21035513 A to T
FTB62516 21071020 G to A
FTB62517 21130478 T to C
FTB62518 21136997 A to C
FTB62519 21275032 A to G
FTB62520 21315433 C to T
FTB62521 21417077 G to A
FTB62522 21466824 A to T
FTB62523 21476350 G to A
FTB62524 21485337 G to A
FTB62525 21488512 T to C
FTB62526 21493149 T to G
FTB62527 21575404 A to C
FTB62528 21752093 G to A
FTB62529 21755117 C to T
FTB62530 21805716 A to T
FTB62531 22211344 C to G
FTB62532 22212840 A to G
FTB62533 22216047 G to T
FTB62534 22222786 G to A
FTB62535 22223705 G to T
FTB62536 22323629 G to A
FTB62537 22339442 C to T
FTB62538 22346540 A to G
FTB62539 22348719 A to T
FTB62540 22354097 C to T
FTB62541 22355380 C to G
FTB62542 22356230 C to G
FTB62543 22363208 T to G
FTB62544 22367508 C to T
FTB62545 22367973 T to C
FTB62546 22373713 T to G
FTB62547 26325426 G to A
FTB62548 5266938 T to C
FTB62549 19437752 A to T
FTB62550 3110990 G to T
FTB62551 16897318 C to A
FTB62552 17174387 C to T
FTB62553 20932857 C to T
FTB62554 4319079 G to C
FTB62555 14451346 AA to A
FTB62556 11739580 A to G
FTB62557 6645881 C to T
FTB62558 10077332 G to C
FTB62559 10204535 T to G
FTB62560 11511407 G to C
FTB62561 20067164 C to A
FTB62562 11022753 T to C
FTB62563 10928690 A to T
FTB62564 11408397 A to G
FTB62565 11307309 G to T
FTB62566 11525848 G to A
FTB62567 2788589 G to A
FTB62568 2789814 C to A
FTB62569 2793787 G to A
FTB62570 2798066 T to C
FTB62571 2810211 C to A
FTB62572 2812713 T to G
FTB62573 2832167 G to A
FTB62574 2833693 A to G
FTB62575 2836607 T to A
FTB62576 2838017 T to C
FTB62577 2847534 C to T
FTB62578 2854289 C to G
FTB62579 2856665 C to T
FTB62580 2860338 G to A
FTB62581 2872210 A to C
FTB62582 2887779 A to G
FTB62583 2888451 G to T
FTB62584 2888990 G to A
FTB62585 2889647 C to T
FTB62586 2894298 T to G
FTB62587 2896684 C to G
FTB62588 2901548 G to T
FTB62589 2904764 C to G
FTB62590 2909618 A to G
FTB62591 2913635 A to G
FTB62592 2925154 T to C
FTB62593 2926037 C to A
FTB62594 2935638 G to A
FTB62595 2937166 A to G
FTB62596 2956915 G to C
FTB62597 2958395 C to G
FTB62598 2959289 A to G
FTB62599 2960869 T to C
FTB62600 2961061 T to C
FTB62601 2974974 C to T
FTB62602 2977070 A to G
FTB62603 2977368 A to C
FTB62604 2998989 A to G
FTB62605 3002711 T to G
FTB62606 3002718 C to T
FTB62607 3011475 G to A
FTB62608 3018377 C to A
FTB62609 3034826 G to A
FTB62610 3040597 C to T
FTB62611 3041305 T to C
FTB62612 6752816 C to A
FTB62613 6778859 C to T
FTB62614 6786832 G to A
FTB62615 6789474 A to G
FTB62616 6792571 G to A
FTB62617 6805710 G to T
FTB62618 6811035 G to A
FTB62619 6817380 A to G
FTB62620 6822459 C to G
FTB62621 6822794 T to C
FTB62622 6823862 G to A
FTB62623 6824125 A to G
FTB62624 6826703 T to C
FTB62625 6834890 T to C
FTB62626 6837100 G to A
FTB62627 6844658 C to T
FTB62628 6846529 G to T
FTB62629 6846530 T to A
FTB62630 6848270 A to G
FTB62631 6849458 G to A
FTB62632 6853747 A to T
FTB62633 6857434 G to A
FTB62634 6859362 T to A
FTB62635 6867232 A to G
FTB62636 6875058 A to G
FTB62637 6877576 A to G
FTB62638 6881221 C to T
FTB62639 6883186 G to A
FTB62640 6885071 A to G
FTB62641 6888705 A to G
FTB62642 6892885 A to C
FTB62643 6899369 G to A
FTB62644 6903687 G to C
FTB62645 6907476 C to T
FTB62646 6909072 T to C
FTB62647 6911062 G to C
FTB62648 6912885 C to T
FTB62649 6913438 A to G
FTB62650 6919013 T to C
FTB62651 6919211 G to C
FTB62652 6921861 T to C
FTB62653 6922027 G to A
FTB62654 6934544 T to A
FTB62655 6940175 T to C
FTB62656 6941143 G to T
FTB62657 6948244 T to C
FTB62658 6949663 C to T
FTB62659 6950833 C to T
FTB62660 6976854 C to A
FTB62661 6977899 G to A
FTB62662 6986042 G to A
FTB62663 6990952 C to G
FTB62664 6995521 G to A
FTB62665 6995980 C to T
FTB62666 7006020 C to T
FTB62667 7008897 T to C
FTB62668 7020406 C to A
FTB62669 7021176 T to C
FTB62670 7024783 T to G
FTB62671 7026096 T to C
FTB62672 7026814 G to T
FTB62673 7029821 A to G
FTB62674 7043347 C to G
FTB62675 7078265 C to T
FTB62676 7080027 C to G
FTB62677 7088600 T to C
FTB62678 7100119 C to G
FTB62679 7106361 C to G
FTB62680 7107332 A to G
FTB62681 7142157 A to C
FTB62682 7160187 A to G
FTB62683 7161530 A to T
FTB62684 7166813 T to C
FTB62685 7172740 C to T
FTB62686 7174633 G to C
FTB62687 7174658 T to C
FTB62688 7174942 G to A
FTB62689 7175228 A to T
FTB62690 7176110 T to C
FTB62691 7177910 A to G
FTB62692 7183480 T to C
FTB62693 7184281 T to G
FTB62694 7185949 G to A
FTB62695 7195578 C to G
FTB62696 7197187 G to C
FTB62697 7204874 C to G
FTB62698 7207676 T to G
FTB62699 7207866 T to G
FTB62700 7210017 G to A
FTB62701 7213505 G to A
FTB62702 7217337 A to T
FTB62703 7218208 G to A
FTB62704 7226081 G to C
FTB62705 7229947 T to C
FTB62706 7231350 A to G
FTB62707 7235515 G to T
FTB62708 7239048 T to C
FTB62709 7239066 G to C
FTB62710 7241475 G to T
FTB62711 7244366 G to T
FTB62712 7247473 G to A
FTB62713 7248576 G to C
FTB62714 7249194 G to C
FTB62715 7258967 T to C
FTB62716 7260239 A to C
FTB62717 7267095 C to T
FTB62718 7274368 T to C
FTB62719 7288882 A to G
FTB62720 7289159 G to T
FTB62721 7291066 G to A
FTB62722 7292406 G to A
FTB62723 7294346 T to G
FTB62724 7296004 G to A
FTB62725 7298820 C to T
FTB62726 7305710 G to A
FTB62727 7309647 C to G
FTB62728 7310242 C to G
FTB62729 7311599 C to G
FTB62730 7312565 A to C
FTB62731 7314495 C to T
FTB62732 7319436 T to C
FTB62733 7331372 C to T
FTB62734 7338266 C to T
FTB62735 7339708 G to C
FTB62736 7344268 C to G
FTB62737 7345793 C to T
FTB62738 7350636 A to C
FTB62739 7356357 G to T
FTB62740 7364925 A to G
FTB62741 7386360 A to C
FTB62742 7388617 A to G
FTB62743 7391923 A to G
FTB62744 7394501 A to G
FTB62745 7402205 C to T
FTB62746 7403064 G to A
FTB62747 7403549 C to T
FTB62748 7411071 G to C
FTB62749 7419970 C to G
FTB62750 7422971 A to G
FTB62751 7424426 A to G
FTB62752 7439004 C to T
FTB62753 7439109 G to A
FTB62754 7441348 C to G
FTB62755 7442894 A to G
FTB62756 7443971 A to G
FTB62757 7443997 A to G
FTB62758 7446266 T to A
FTB62759 7454590 C to T
FTB62760 7455005 G to A
FTB62761 7457593 A to G
FTB62762 7458431 C to A
FTB62763 7464398 C to T
FTB62764 7467417 G to A
FTB62765 7468409 C to A
FTB62766 7486064 T to G
FTB62767 7491620 C to T
FTB62768 7492894 G to A
FTB62769 7500945 C to T
FTB62770 7502217 A to T
FTB62771 7504604 C to A
FTB62772 7508543 T to C
FTB62773 7520789 C to T
FTB62774 7523222 G to T
FTB62775 7523275 T to C
FTB62776 7523537 C to T
FTB62777 7526449 G to T
FTB62778 7540226 T to C
FTB62779 7549018 A to C
FTB62780 7549463 G to A
FTB62781 7560289 C to T
FTB62782 7565316 T to G
FTB62783 7566346 C to G
FTB62784 7574487 T to C
FTB62785 7576055 C to T
FTB62786 7578081 G to A
FTB62787 7588198 A to T
FTB62788 7594601 C to T
FTB62789 7595623 A to T
FTB62790 7598860 A to G
FTB62791 7604385 A to G
FTB62792 7650002 G to A
FTB62793 7652322 C to G
FTB62794 7656080 G to A
FTB62795 7666756 A to G
FTB62796 7672782 C to G
FTB62797 7673268 A to C
FTB62798 7681868 C to T
FTB62799 7683649 T to G
FTB62800 7695901 T to C
FTB62801 7699306 C to G
FTB62802 7701941 G to C
FTB62803 7714522 G to A
FTB62804 7720463 C to G
FTB62805 7721819 T to C
FTB62806 7723998 G to A
FTB62807 7729952 A to T
FTB62808 7731330 C to T
FTB62809 7736468 T to A
FTB62810 7743314 A to G
FTB62811 7743478 G to A
FTB62812 7755659 C to G
FTB62813 7757718 G to A
FTB62814 7777213 C to A
FTB62815 7778009 G to C
FTB62816 7798108 C to A
FTB62817 7799282 G to A
FTB62818 7809594 G to A
FTB62819 7815944 C to A
FTB62820 7822769 T to C
FTB62821 7823874 G to A
FTB62822 7832505 A to G
FTB62823 7856122 G to T
FTB62824 7860799 C to T
FTB62825 7861307 A to C
FTB62826 7868294 A to T
FTB62827 7869239 C to T
FTB62828 7872301 A to G
FTB62829 7874503 A to C
FTB62830 7877010 A to T
FTB62831 7878944 T to G
FTB62832 7879573 G to A
FTB62833 7883151 A to C
FTB62834 7891048 C to G
FTB62835 7894727 A to G
FTB62836 7898256 A to G
FTB62837 7899120 T to C
FTB62838 7904801 G to C
FTB62839 7905524 A to G
FTB62840 7907042 A to G
FTB62841 7917750 T to C
FTB62842 7921957 A to G
FTB62843 7937507 T to C
FTB62844 7940614 G to A
FTB62845 7944700 G to A
FTB62846 7947206 G to C
FTB62847 7951681 C to T
FTB62848 7961293 T to G
FTB62849 7963159 C to A
FTB62850 7991247 C to T
FTB62851 7995632 T to C
FTB62852 7995804 T to A
FTB62853 8002589 A to C
FTB62854 8011677 A to T
FTB62855 8017025 G to C
FTB62856 8025027 A to C
FTB62857 8033094 T to C
FTB62858 8047776 C to T
FTB62859 8048671 G to T
FTB62860 8061448 G to A
FTB62861 8064175 A to G
FTB62862 8068083 A to T
FTB62863 8071290 G to A
FTB62864 8079096 C to T
FTB62865 8096577 C to G
FTB62866 8105110 T to G
FTB62867 8106215 C to T
FTB62868 8119993 A to G
FTB62869 8128833 G to C
FTB62870 8132123 A to T
FTB62871 8134357 G to A
FTB62872 8134931 G to C
FTB62873 8142945 C to T
FTB62874 8143452 G to C
FTB62875 8156352 C to G
FTB62876 8170976 G to A
FTB62877 8172937 C to T
FTB62878 8179768 A to G
FTB62879 8180064 T to A
FTB62880 8185788 A to G
FTB62881 8188923 A to C
FTB62882 8190953 T to C
FTB62883 8192467 A to G
FTB62884 8199550 C to T
FTB62885 8203026 A to G
FTB62886 8206333 C to T
FTB62887 8213127 C to A
FTB62888 8214109 G to T
FTB62889 8216869 A to G
FTB62890 8221060 T to A
FTB62891 8224646 A to G
FTB62892 8225461 A to T
FTB62893 8225482 A to C
FTB62894 8225939 G to T
FTB62895 8226068 C to T
FTB62896 8228933 T to C
FTB62897 8229608 A to G
FTB62898 8230414 A to G
FTB62899 8231682 C to T
FTB62900 8233947 G to A
FTB62901 8237659 C to A
FTB62902 8239440 A to T
FTB62903 8266219 C to T
FTB62904 8272484 C to T
FTB62905 8273677 T to C
FTB62906 8294104 T to C
FTB62907 8300294 G to A
FTB62908 8301341 C to T
FTB62909 8310982 T to A
FTB62910 8311137 T to C
FTB62911 8319514 A to G
FTB62912 8319776 C to G
FTB62913 8323673 C to T
FTB62914 8327668 T to G
FTB62915 8329424 C to A
FTB62916 8331136 C to G
FTB62917 8332174 G to T
FTB62918 8332728 G to C
FTB62919 8335720 A to G
FTB62920 8336496 G to A
FTB62921 8337059 C to T
FTB62922 8341796 T to C
FTB62923 8341825 T to C
FTB62924 8342390 C to T
FTB62925 8343298 T to C
FTB62926 8351051 T to C
FTB62927 8361691 A to G
FTB62928 8362251 G to T
FTB62929 8381813 C to T
FTB62930 8385082 G to T
FTB62931 8388169 A to C
FTB62932 8388783 T to C
FTB62933 8397128 A to G
FTB62934 8399433 T to G
FTB62935 8405095 A to G
FTB62936 8414837 T to C
FTB62937 8415663 T to A
FTB62938 8417690 T to A
FTB62939 8423980 T to A
FTB62940 8429446 G to A
FTB62941 8429982 G to T
FTB62942 8430370 C to A
FTB62943 8433122 C to A
FTB62944 8439492 G to C
FTB62945 8441222 G to T
FTB62946 8443276 T to A
FTB62947 8471777 G to A
FTB62948 8472089 T to C
FTB62949 8473609 G to C
FTB62950 8486865 C to G
FTB62951 8489932 T to C
FTB62952 8493903 T to C
FTB62953 8495728 C to A
FTB62954 8498810 A to G
FTB62955 8505082 C to T
FTB62956 8530973 G to A
FTB62957 8539704 C to A
FTB62958 8543969 C to A
FTB62959 8546155 A to G
FTB62960 8560376 C to G
FTB62961 8562535 G to A
FTB62962 8562604 C to T
FTB62963 8563443 G to A
FTB62964 8564774 T to G
FTB62965 8567431 T to A
FTB62966 8567585 G to A
FTB62967 8574377 G to C
FTB62968 8576533 T to A
FTB62969 8577114 C to G
FTB62970 8577563 G to A
FTB62971 8599082 A to C
FTB62972 8599562 C to G
FTB62973 8599870 T to C
FTB62974 8601492 C to A
FTB62975 8604180 A to T
FTB62976 8613584 C to T
FTB62977 8614682 C to A
FTB62978 8619366 G to A
FTB62979 8621331 C to G
FTB62980 8637118 T to C
FTB62981 8640540 G to A
FTB62982 8644603 T to C
FTB62983 8662053 G to A
FTB62984 8662327 G to A
FTB62985 8662746 T to C
FTB62986 8663422 A to G
FTB62987 8666510 C to T
FTB62988 8668695 T to C
FTB62989 8669765 G to A
FTB62990 8670231 T to C
FTB62991 8674389 T to C
FTB62992 8675709 T to C
FTB62993 8682913 C to G
FTB62994 8690720 C to G
FTB62995 8695132 G to A
FTB62996 8695245 A to G
FTB62997 8698262 G to A
FTB62998 8699203 A to G
FTB62999 8699855 C to T
FTB63000 8701157 A to T
FTB63001 8703378 T to A
FTB63002 8710536 G to C
FTB63003 8711019 G to A
FTB63004 8711320 C to T
FTB63005 8714154 C to T
FTB63006 8715456 A to T
FTB63007 8718444 A to G
FTB63008 8720096 T to G
FTB63009 8727388 T to G
FTB63010 8728156 G to T
FTB63011 8728660 T to G
FTB63012 8729691 A to G
FTB63013 8730715 T to C
FTB63014 8730981 A to G
FTB63015 8743502 G to A
FTB63016 8761495 C to T
FTB63017 8779344 C to T
FTB63018 8780142 A to G
FTB63019 8782571 T to C
FTB63020 8783275 G to C
FTB63021 8793626 A to T
FTB63022 8795247 G to T
FTB63023 8795527 G to A
FTB63024 8798680 A to G
FTB63025 8801237 C to T
FTB63026 8801362 G to T
FTB63027 8803498 G to A
FTB63028 8804480 A to G
FTB63029 8807299 T to C
FTB63030 8809001 C to T
FTB63031 8816323 G to T
FTB63032 8827675 A to G
FTB63033 8830344 G to A
FTB63034 8835689 T to C
FTB63035 8836585 C to T
FTB63036 8841285 G to A
FTB63037 8841657 G to A
FTB63038 8851100 C to T
FTB63039 8851416 C to G
FTB63040 8854175 C to T
FTB63041 8869697 G to A
FTB63042 8875027 C to T
FTB63043 8882232 C to T
FTB63044 8883114 G to A
FTB63045 8886204 G to A
FTB63046 8886318 A to C
FTB63047 8887626 G to C
FTB63048 8887998 C to T
FTB63049 8890129 T to C
FTB63050 8891381 G to C
FTB63051 8892520 G to T
FTB63052 8904140 A to T
FTB63053 8904696 T to A
FTB63054 8905779 A to G
FTB63055 8914121 C to T
FTB63056 8915917 C to T
FTB63057 8926994 A to G
FTB63058 8940060 A to C
FTB63059 8950933 A to G
FTB63060 8953822 A to G
FTB63061 8970973 T to C
FTB63062 8972844 G to A
FTB63063 8980651 A to G
FTB63064 8983673 A to T
FTB63065 8984917 T to G
FTB63066 8986718 G to C
FTB63067 8990887 G to C
FTB63068 8994875 G to A
FTB63069 8995065 G to A
FTB63070 8995689 A to T
FTB63071 9015869 T to G
FTB63072 9026944 C to G
FTB63073 9029474 A to T
FTB63074 9036192 A to G
FTB63075 9124014 A to G
FTB63076 9125532 C to T
FTB63077 9127046 C to T
FTB63078 9128197 A to C
FTB63079 9143196 T to C
FTB63080 9160370 A to G
FTB63081 9166825 T to C
FTB63082 9173570 G to A
FTB63083 9185977 A to G
FTB63084 9189412 A to T
FTB63085 9190123 C to T
FTB63086 9192703 C to G
FTB63087 9198129 C to A
FTB63088 9200096 T to G
FTB63089 9205406 A to G
FTB63090 9224991 A to G
FTB63091 9239258 C to G
FTB63092 9246215 C to A
FTB63093 9252566 C to T
FTB63094 9259013 C to T
FTB63095 9265701 C to T
FTB63096 9267583 T to C
FTB63097 9267584 T to C
FTB63098 9274291 A to G
FTB63099 9275263 A to G
FTB63100 9276851 G to A
FTB63101 9286403 C to G
FTB63102 9290349 T to C
FTB63103 9293031 A to G
FTB63104 9303215 A to T
FTB63105 9306965 G to T
FTB63106 9310072 A to G
FTB63107 9316133 T to C
FTB63108 9320290 C to T
FTB63109 9325494 G to T
FTB63110 9326708 C to G
FTB63111 9333047 C to A
FTB63112 9564768 A to G
FTB63113 9570740 A to G
FTB63114 9573273 C to T
FTB63115 9577048 A to G
FTB63116 9577416 T to C
FTB63117 9579690 T to C
FTB63118 9580210 C to G
FTB63119 9583482 G to A
FTB63120 9589400 G to T
FTB63121 9600697 G to A
FTB63122 9605518 T to C
FTB63123 9607493 G to A
FTB63124 9615752 G to C
FTB63125 9616427 T to C
FTB63126 9619312 C to T
FTB63127 9620530 C to T
FTB63128 9961659 G to A
FTB63129 9967673 T to C
FTB63130 9975716 T to G
FTB63131 9979434 T to C
FTB63132 9981877 T to C
FTB63133 9983746 A to G
FTB63134 9992447 A to G
FTB63135 10010816 G to A
FTB63136 10016723 G to A
FTB63137 10024547 C to T
FTB63138 10031077 C to T
FTB63139 10043234 G to C
FTB63140 10045016 T to G
FTB63141 10046170 C to T
FTB63142 10046647 C to A
FTB63143 10049948 G to A
FTB63144 10052048 T to C
FTB63145 10057761 G to A
FTB63146 10059356 A to G
FTB63147 10060136 A to C
FTB63148 10060325 T to G
FTB63149 10060624 A to C
FTB63150 11758274 T to C
FTB63151 11760755 G to A
FTB63152 11761853 C to A
FTB63153 11762560 A to G
FTB63154 11763504 A to G
FTB63155 11768634 C to A
FTB63156 11775322 G to T
FTB63157 11775952 A to G
FTB63158 11778911 C to A
FTB63159 11781179 C to T
FTB63160 11783208 C to T
FTB63161 11784676 A to G
FTB63162 11786326 C to A
FTB63163 11786995 G to T
FTB63164 11797600 G to A
FTB63165 11802325 C to T
FTB63166 11804216 T to C
FTB63167 11804684 T to C
FTB63168 11816935 C to T
FTB63169 11819557 C to G
FTB63170 11820372 T to C
FTB63171 11823293 C to T
FTB63172 11825151 G to A
FTB63173 11826637 T to C
FTB63174 11826850 T to A
FTB63175 11829163 T to C
FTB63176 11845687 T to A
FTB63177 11852452 G to C
FTB63178 11852763 T to C
FTB63179 11853098 A to G
FTB63180 11854039 T to A
FTB63181 11862124 A to G
FTB63182 11864933 C to A
FTB63183 11866624 G to C
FTB63184 11867294 G to A
FTB63185 11871909 G to A
FTB63186 11873617 C to T
FTB63187 11878195 C to T
FTB63188 11879209 C to T
FTB63189 11882905 T to C
FTB63190 11882911 T to C
FTB63191 11890454 A to G
FTB63192 11891064 G to T
FTB63193 11894310 G to A
FTB63194 11894458 A to T
FTB63195 11894490 G to A
FTB63196 11894678 C to T
FTB63197 11895727 C to T
FTB63198 11899993 C to T
FTB63199 11900436 A to T
FTB63200 11906169 A to G
FTB63201 11908518 G to A
FTB63202 11913591 G to A
FTB63203 11915603 G to A
FTB63204 11919404 G to A
FTB63205 11922682 C to T
FTB63206 11922796 A to G
FTB63207 11924587 G to T
FTB63208 11926250 C to T
FTB63209 11931888 C to T
FTB63210 11934243 C to T
FTB63211 11939845 C to T
FTB63212 11941689 G to A
FTB63213 11941985 C to A
FTB63214 11945965 A to T
FTB63215 11954158 G to C
FTB63216 11955896 G to T
FTB63217 11969589 G to A
FTB63218 11970027 G to A
FTB63219 11971321 C to A
FTB63220 11974877 C to T
FTB63221 11976486 T to A
FTB63222 11977416 T to A
FTB63223 11984362 A to G
FTB63224 11984593 C to T
FTB63225 11986448 G to T
FTB63226 11986761 C to A
FTB63227 11996637 A to G
FTB63228 11996720 G to A
FTB63229 12003006 A to G
FTB63230 12019149 G to T
FTB63231 12019658 G to A
FTB63232 12024440 A to C
FTB63233 12026315 A to G
FTB63234 12028758 G to T
FTB63235 12030429 G to A
FTB63236 12050309 A to G
FTB63237 12053558 C to A
FTB63238 12053604 G to A
FTB63239 12054001 G to T
FTB63240 12063182 T to C
FTB63241 12067512 C to T
FTB63242 12069571 T to C
FTB63243 12076905 C to T
FTB63244 12079233 G to C
FTB63245 12082316 T to C
FTB63246 12087369 G to T
FTB63247 12089159 T to C
FTB63248 12089430 G to T
FTB63249 12090270 A to G
FTB63250 12091955 C to T
FTB63251 12092161 G to C
FTB63252 12097645 A to G
FTB63253 12098093 A to G
FTB63254 12099030 T to G
FTB63255 12100026 A to T
FTB63256 12100739 G to A
FTB63257 12100741 C to T
FTB63258 12102105 G to T
FTB63259 12102594 C to T
FTB63260 12105130 A to G
FTB63261 12105360 T to A
FTB63262 12107094 C to T
FTB63263 12109722 C to T
FTB63264 12110575 C to T
FTB63265 12118758 C to G
FTB63266 12119719 T to C
FTB63267 12122972 C to T
FTB63268 12128778 T to G
FTB63269 12129548 G to A
FTB63270 12129932 C to T
FTB63271 12133128 C to T
FTB63272 12141970 T to C
FTB63273 12143600 A to T
FTB63274 12145577 A to T
FTB63275 12149908 A to G
FTB63276 12149913 G to A
FTB63277 12150895 C to A
FTB63278 12151219 A to G
FTB63279 12156896 A to G
FTB63280 12159569 T to A
FTB63281 12161286 G to A
FTB63282 12162454 T to A
FTB63283 12163011 G to A
FTB63284 12167707 A to T
FTB63285 12173956 A to G
FTB63286 12176241 G to T
FTB63287 12192242 T to C
FTB63288 12194150 G to A
FTB63289 12197517 C to A
FTB63290 12199861 T to C
FTB63291 12201067 C to T
FTB63292 12211805 G to T
FTB63293 12211958 T to C
FTB63294 12212222 C to G
FTB63295 12212939 C to T
FTB63296 12216973 C to T
FTB63297 12227063 G to A
FTB63298 12230426 T to C
FTB63299 12233113 G to A
FTB63300 12237534 G to A
FTB63301 12247016 A to G
FTB63302 12248430 G to T
FTB63303 12248800 A to G
FTB63304 12249475 T to C
FTB63305 12255150 A to C
FTB63306 12258243 A to T
FTB63307 12261606 G to A
FTB63308 12263959 T to G
FTB63309 12264410 C to A
FTB63310 12267398 G to A
FTB63311 12267573 T to C
FTB63312 12268246 A to C
FTB63313 12268752 A to G
FTB63314 12269790 G to A
FTB63315 12272891 T to A
FTB63316 12273713 C to G
FTB63317 12287238 C to T
FTB63318 12287406 G to A
FTB63319 12289442 T to C
FTB63320 12290606 G to A
FTB63321 12291623 G to T
FTB63322 12292324 T to G
FTB63323 12298802 G to C
FTB63324 12299925 G to C
FTB63325 12303080 A to G
FTB63326 12303401 C to T
FTB63327 12316774 G to A
FTB63328 12321422 G to T
FTB63329 12323343 T to G
FTB63330 12330883 C to G
FTB63331 12340971 C to T
FTB63332 12347616 C to G
FTB63333 12360192 A to G
FTB63334 12365579 C to T
FTB63335 12368743 G to A
FTB63336 12375948 T to C
FTB63337 12380780 C to T
FTB63338 12411194 A to G
FTB63339 12424356 A to G
FTB63340 12425345 G to T
FTB63341 12428377 G to A
FTB63342 12439178 C to T
FTB63343 12446981 C to T
FTB63344 12448852 C to T
FTB63345 12471735 G to A
FTB63346 12475140 C to T
FTB63347 12482142 G to T
FTB63348 12496696 A to G
FTB63349 12498184 T to A
FTB63350 12505303 G to T
FTB63351 12509773 T to G
FTB63352 12517987 T to A
FTB63353 12519091 G to A
FTB63354 12523407 T to A
FTB63355 12525642 G to C
FTB63356 12527442 A to G
FTB63357 12527686 T to C
FTB63358 12549663 A to G
FTB63359 12553347 C to T
FTB63360 12559565 T to C
FTB63361 12567138 G to C
FTB63362 12575928 T to A
FTB63363 12580473 A to C
FTB63364 12582554 A to T
FTB63365 12589551 C to A
FTB63366 12599340 A to T
FTB63367 12603996 T to C
FTB63368 12608284 G to A
FTB63369 12632302 C to T
FTB63370 12653787 C to T
FTB63371 12663442 C to T
FTB63372 12663447 C to T
FTB63373 12664914 G to A
FTB63374 12665031 C to G
FTB63375 12676130 C to T
FTB63376 12676362 A to G
FTB63377 12676529 T to C
FTB63378 12678672 T to A
FTB63379 12680076 C to T
FTB63380 12686676 C to T
FTB63381 12687262 G to T
FTB63382 12687263 G to C
FTB63383 12694059 T to C
FTB63384 12701781 A to T
FTB63385 12705072 C to A
FTB63386 12708890 A to G
FTB63387 12715311 G to C
FTB63388 12720795 A to G
FTB63389 12723046 G to A
FTB63390 12723382 T to A
FTB63391 12730885 A to G
FTB63392 12742635 A to G
FTB63393 12756991 C to G
FTB63394 12767274 C to T
FTB63395 12771861 A to G
FTB63396 12776401 A to C
FTB63397 12785460 A to G
FTB63398 12794832 A to G
FTB63399 12797511 A to G
FTB63400 12799690 C to T
FTB63401 12803173 G to A
FTB63402 12803752 T to C
FTB63403 12818152 A to G
FTB63404 12825149 T to G
FTB63405 12825795 G to A
FTB63406 12831038 G to C
FTB63407 12831039 C to T
FTB63408 12831174 C to G
FTB63409 12837773 G to A
FTB63410 12838258 T to G
FTB63411 12839597 G to A
FTB63412 12840285 A to G
FTB63413 12842168 C to A
FTB63414 12854752 T to C
FTB63415 12856051 G to A
FTB63416 12858514 G to T
FTB63417 12860670 T to C
FTB63418 12866534 C to A
FTB63419 12869257 C to T
FTB63420 12877226 A to T
FTB63421 12883150 A to G
FTB63422 12888166 T to G
FTB63423 12888597 A to T
FTB63424 12891187 G to A
FTB63425 12898861 G to T
FTB63426 12899017 A to C
FTB63427 12903523 G to C
FTB63428 12909860 G to A
FTB63429 12912654 C to A
FTB63430 12914063 A to G
FTB63431 12916615 A to G
FTB63432 12918063 A to G
FTB63433 12923220 T to G
FTB63434 12924720 C to T
FTB63435 12927736 A to C
FTB63436 12930442 C to A
FTB63437 12932410 C to T
FTB63438 12934872 G to C
FTB63439 12935751 G to A
FTB63440 12936927 A to G
FTB63441 12941086 G to A
FTB63442 12945690 C to T
FTB63443 12948079 C to A
FTB63444 12968485 G to A
FTB63445 12969724 T to C
FTB63446 12969922 A to G
FTB63447 12991667 C to G
FTB63448 12997650 T to G
FTB63449 13016537 C to G
FTB63450 13017967 G to T
FTB63451 13017968 C to T
FTB63452 13022122 A to C
FTB63453 13040862 A to G
FTB63454 13041372 A to G
FTB63455 13042020 G to A
FTB63456 13051350 G to A
FTB63457 13052488 G to A
FTB63458 13056226 T to C
FTB63459 13057218 A to G
FTB63460 13064611 C to G
FTB63461 13066651 C to A
FTB63462 13068632 T to C
FTB63463 13087826 G to C
FTB63464 13091394 G to C
FTB63465 13098968 T to C
FTB63466 13099003 C to A
FTB63467 13104852 A to G
FTB63468 13115784 G to C
FTB63469 13122163 C to T
FTB63470 13123080 G to A
FTB63471 13129188 A to G
FTB63472 13140260 C to A
FTB63473 13140363 A to C
FTB63474 13142799 T to C
FTB63475 13148004 T to C
FTB63476 13148281 G to T
FTB63477 13159912 A to C
FTB63478 13161987 T to A
FTB63479 13171430 A to G
FTB63480 13173611 C to T
FTB63481 13174570 C to T
FTB63482 13187560 G to A
FTB63483 13192492 T to C
FTB63484 13197843 C to A
FTB63485 13198590 T to C
FTB63486 13200717 A to G
FTB63487 13203530 G to A
FTB63488 13204646 G to A
FTB63489 13206961 T to C
FTB63490 13210657 C to T
FTB63491 13221261 G to T
FTB63492 13225429 C to T
FTB63493 13229197 C to T
FTB63494 13232726 G to A
FTB63495 13234674 A to G
FTB63496 13241857 G to A
FTB63497 13248250 C to T
FTB63498 13254646 A to G
FTB63499 13273835 A to T
FTB63500 13275727 G to A
FTB63501 13282493 C to T
FTB63502 13282761 G to A
FTB63503 13288162 C to T
FTB63504 13292829 G to A
FTB63505 13293931 G to C
FTB63506 13295849 T to C
FTB63507 13298143 G to A
FTB63508 13299328 T to G
FTB63509 13305509 G to C
FTB63510 13305866 T to G
FTB63511 13306506 A to G
FTB63512 13311011 C to A
FTB63513 13312358 A to T
FTB63514 13314986 G to T
FTB63515 13315436 C to T
FTB63516 13321094 A to T
FTB63517 13327221 G to T
FTB63518 13338588 A to T
FTB63519 13343006 G to T
FTB63520 13360856 C to G
FTB63521 13363310 C to T
FTB63522 13365535 T to C
FTB63523 13373426 C to A
FTB63524 13388376 T to C
FTB63525 13390423 T to C
FTB63526 13397548 T to A
FTB63527 13399322 T to C
FTB63528 13402148 T to C
FTB63529 13407522 G to T
FTB63530 13409433 T to C
FTB63531 13410852 A to C
FTB63532 13413555 C to G
FTB63533 13419876 A to C
FTB63534 13420481 C to T
FTB63535 13427541 C to T
FTB63536 13435408 T to C
FTB63537 13446299 C to A
FTB63538 13446301 T to A
FTB63539 13452430 A to G
FTB63540 13455361 G to A
FTB63541 13462599 C to T
FTB63542 13464012 A to T
FTB63543 13468443 A to C
FTB63544 13479818 C to G
FTB63545 13483562 G to A
FTB63546 13487915 C to G
FTB63547 13495347 T to C
FTB63548 13499712 A to G
FTB63549 13501349 A to G
FTB63550 13507431 A to G
FTB63551 13509308 C to G
FTB63552 13509708 C to G
FTB63553 13510435 G to A
FTB63554 13536223 C to A
FTB63555 13539522 C to T
FTB63556 13542035 T to G
FTB63557 13549048 C to T
FTB63558 13558436 T to A
FTB63559 13569818 C to T
FTB63560 13581760 G to A
FTB63561 13583757 G to T
FTB63562 13584679 T to C
FTB63563 13585561 C to A
FTB63564 13585875 A to C
FTB63565 13589366 C to G
FTB63566 13591162 C to G
FTB63567 13595131 A to G
FTB63568 13595941 C to T
FTB63569 13606142 G to A
FTB63570 13607943 G to C
FTB63571 13611835 G to T
FTB63572 13614719 C to T
FTB63573 13615260 C to A
FTB63574 13618106 G to A
FTB63575 13618579 A to G
FTB63576 13627112 G to T
FTB63577 13627147 C to A
FTB63578 13628926 C to T
FTB63579 13629987 T to C
FTB63580 13635608 C to T
FTB63581 13637484 T to A
FTB63582 13639785 C to T
FTB63583 13640127 A to G
FTB63584 13649023 C to T
FTB63585 13652228 C to T
FTB63586 13660655 C to G
FTB63587 13664162 C to A
FTB63588 13666995 T to A
FTB63589 13668541 C to A
FTB63590 13674576 A to C
FTB63591 13684773 T to G
FTB63592 13686262 A to T
FTB63593 13688091 A to C
FTB63594 13688852 G to A
FTB63595 13689115 A to G
FTB63596 13706927 C to A
FTB63597 13714273 G to A
FTB63598 13715326 G to A
FTB63599 13716520 C to G
FTB63600 13716635 C to T
FTB63601 13719056 C to T
FTB63602 13748575 T to G
FTB63603 13754850 C to T
FTB63604 13755316 C to T
FTB63605 13765097 T to G
FTB63606 13766418 C to A
FTB63607 13768210 C to A
FTB63608 13770080 C to T
FTB63609 13770800 C to A
FTB63610 13776659 C to A
FTB63611 13783781 G to T
FTB63612 13784990 C to T
FTB63613 13806411 T to C
FTB63614 13810623 A to G
FTB63615 13817757 G to T
FTB63616 13827949 G to A
FTB63617 13831522 C to T
FTB63618 13832618 A to G
FTB63619 13836951 G to A
FTB63620 13838034 A to G
FTB63621 13839358 C to T
FTB63622 13841776 A to G
FTB63623 13851968 G to A
FTB63624 13854411 A to T
FTB63625 13860973 C to A
FTB63626 13862765 G to A
FTB63627 13875390 C to T
FTB63628 13883226 A to G
FTB63629 13886539 G to A
FTB63630 13893889 C to T
FTB63631 13899154 A to C
FTB63632 13907250 T to C
FTB63633 13919458 A to G
FTB63634 13919867 T to C
FTB63635 13920947 G to T
FTB63636 13922717 T to C
FTB63637 13923443 G to C
FTB63638 13924255 G to C
FTB63639 13927209 A to G
FTB63640 13931498 A to T
FTB63641 13936197 A to G
FTB63642 13937010 G to A
FTB63643 13941631 C to G
FTB63644 13942260 C to G
FTB63645 13945781 A to G
FTB63646 13966397 G to A
FTB63647 13976082 A to T
FTB63648 13978895 A to G
FTB63649 13980209 T to A
FTB63650 13982679 A to G
FTB63651 13983037 C to G
FTB63652 13983056 A to G
FTB63653 14060758 T to A
FTB63654 14061195 G to A
FTB63655 14064217 T to G
FTB63656 14066478 T to A
FTB63657 14069181 T to C
FTB63658 14070782 G to C
FTB63659 14074994 A to C
FTB63660 14080577 G to A
FTB63661 14080737 A to G
FTB63662 14080871 C to T
FTB63663 14081351 G to A
FTB63664 14089946 T to C
FTB63665 14091147 G to A
FTB63666 14100446 C to T
FTB63667 14105288 G to T
FTB63668 14105752 G to T
FTB63669 14107043 A to T
FTB63670 14113046 G to A
FTB63671 14113576 A to G
FTB63672 14124973 A to T
FTB63673 14130096 C to G
FTB63674 14131526 T to C
FTB63675 14134703 G to A
FTB63676 14140346 G to A
FTB63677 14142465 G to A
FTB63678 14142555 C to A
FTB63679 14147356 T to C
FTB63680 14149307 G to T
FTB63681 14153469 C to T
FTB63682 14154002 C to T
FTB63683 14156573 G to C
FTB63684 14159970 T to A
FTB63685 14161652 C to A
FTB63686 14161768 C to T
FTB63687 14163435 T to C
FTB63688 14174285 T to A
FTB63689 14177103 T to C
FTB63690 14182628 T to A
FTB63691 14185890 T to C
FTB63692 14203227 A to T
FTB63693 14204049 A to C
FTB63694 14205869 G to T
FTB63695 14213578 A to C
FTB63696 14214617 C to T
FTB63697 14227328 T to C
FTB63698 14228003 C to A
FTB63699 14230430 A to G
FTB63700 14230825 G to A
FTB63701 14232553 T to C
FTB63702 14233091 T to C
FTB63703 14235591 G to A
FTB63704 14236148 G to C
FTB63705 14242506 C to A
FTB63706 14242736 A to G
FTB63707 14248385 T to C
FTB63708 14250127 A to G
FTB63709 14254433 G to T
FTB63710 14256213 C to G
FTB63711 14260151 C to T
FTB63712 14260476 A to G
FTB63713 14260479 C to T
FTB63714 14279915 G to A
FTB63715 14281810 G to A
FTB63716 14288235 T to C
FTB63717 14289126 T to C
FTB63718 14293997 C to T
FTB63719 14297880 A to G
FTB63720 14300280 A to G
FTB63721 14304953 T to G
FTB63722 14310703 A to G
FTB63723 14313140 C to G
FTB63724 14316973 G to A
FTB63725 14317288 C to T
FTB63726 14321386 A to G
FTB63727 14324000 C to T
FTB63728 14324790 A to T
FTB63729 14326674 C to A
FTB63730 14330932 T to C
FTB63731 14333489 G to A
FTB63732 14333830 C to T
FTB63733 14333980 G to A
FTB63734 14335471 A to G
FTB63735 14344937 C to T
FTB63736 14345036 A to T
FTB63737 14352975 T to A
FTB63738 14353591 C to G
FTB63739 14354164 A to G
FTB63740 14354485 C to T
FTB63741 14362502 T to G
FTB63742 14371494 A to T
FTB63743 14371768 T to C
FTB63744 14377741 T to C
FTB63745 14384811 G to C
FTB63746 14392066 T to C
FTB63747 14393274 A to T
FTB63748 14398350 C to T
FTB63749 14405271 G to A
FTB63750 14412415 G to A
FTB63751 14418971 A to G
FTB63752 14420829 T to C
FTB63753 14428095 G to C
FTB63754 14444465 T to A
FTB63755 14451216 T to C
FTB63756 14452592 C to T
FTB63757 14454806 G to C
FTB63758 14456921 G to C
FTB63759 14457179 G to C
FTB63760 14457377 C to T
FTB63761 14465845 T to C
FTB63762 14466406 C to A
FTB63763 14466502 C to T
FTB63764 14476849 C to A
FTB63765 14491815 T to C
FTB63766 14492254 C to A
FTB63767 14494927 A to T
FTB63768 14496342 A to G
FTB63769 14500274 T to G
FTB63770 14505973 T to A
FTB63771 14514244 C to A
FTB63772 14515158 A to C
FTB63773 14528332 A to T
FTB63774 14533417 G to T
FTB63775 14543177 T to C
FTB63776 14543916 T to C
FTB63777 14554310 C to T
FTB63778 14554689 G to C
FTB63779 14568050 C to T
FTB63780 14569739 T to C
FTB63781 14570754 C to A
FTB63782 14576988 C to T
FTB63783 14578050 G to A
FTB63784 14580682 T to C
FTB63785 14581141 T to C
FTB63786 14586977 A to G
FTB63787 14596578 T to C
FTB63788 14606447 G to A
FTB63789 14609146 T to A
FTB63790 14622933 A to G
FTB63791 14640185 T to C
FTB63792 14647639 G to A
FTB63793 14650405 T to G
FTB63794 14656162 C to A
FTB63795 14657584 A to G
FTB63796 14665605 G to A
FTB63797 14671906 A to G
FTB63798 14679410 T to C
FTB63799 14681689 A to G
FTB63800 14684614 C to T
FTB63801 14685178 T to G
FTB63802 14688741 C to A
FTB63803 14689698 A to T
FTB63804 14693093 C to T
FTB63805 14695934 G to A
FTB63806 14698033 A to G
FTB63807 14701906 A to G
FTB63808 14702188 T to C
FTB63809 14715247 A to C
FTB63810 14719240 T to G
FTB63811 14721145 G to A
FTB63812 14734517 A to G
FTB63813 14736526 G to C
FTB63814 14737228 C to T
FTB63815 14741247 T to C
FTB63816 14744136 A to C
FTB63817 14751379 G to A
FTB63818 14757095 T to C
FTB63819 14761546 A to G
FTB63820 14761821 A to G
FTB63821 14766399 A to C
FTB63822 14766712 G to A
FTB63823 14768902 T to C
FTB63824 14773563 A to G
FTB63825 14778921 T to C
FTB63826 14798422 T to C
FTB63827 14803536 A to G
FTB63828 14806328 C to G
FTB63829 14807356 A to G
FTB63830 14809453 C to T
FTB63831 14809691 G to A
FTB63832 14812211 C to G
FTB63833 14813940 G to A
FTB63834 14816178 C to T
FTB63835 14831835 G to C
FTB63836 14835101 T to C
FTB63837 14838004 C to T
FTB63838 14846040 A to T
FTB63839 14850240 C to G
FTB63840 14852312 T to C
FTB63841 14854694 T to C
FTB63842 14856158 G to A
FTB63843 14859205 C to G
FTB63844 14860057 A to G
FTB63845 14872895 C to T
FTB63846 14872913 G to C
FTB63847 14875116 C to A
FTB63848 14878199 C to G
FTB63849 14881942 C to G
FTB63850 14889532 C to G
FTB63851 14890669 C to T
FTB63852 14892793 A to G
FTB63853 14894164 G to A
FTB63854 14896456 C to T
FTB63855 14898660 A to G
FTB63856 14902655 G to A
FTB63857 14907703 C to T
FTB63858 14910537 C to T
FTB63859 14917961 G to C
FTB63860 14919096 C to T
FTB63861 14920547 G to A
FTB63862 14936310 C to T
FTB63863 14936986 A to T
FTB63864 14942738 G to A
FTB63865 14960333 A to G
FTB63866 14964052 C to A
FTB63867 14965826 T to C
FTB63868 14967920 C to T
FTB63869 14973943 A to G
FTB63870 14974399 G to C
FTB63871 14975121 T to C
FTB63872 14980323 T to A
FTB63873 14981358 C to T
FTB63874 14984235 G to T
FTB63875 14990334 C to T
FTB63876 14999086 C to A
FTB63877 14999432 T to C
FTB63878 15016960 T to C
FTB63879 15019653 A to G
FTB63880 15023626 G to C
FTB63881 15024416 C to T
FTB63882 15026314 G to A
FTB63883 15033547 T to C
FTB63884 15039416 C to T
FTB63885 15047234 C to T
FTB63886 15055086 A to G
FTB63887 15055745 T to G
FTB63888 15057528 G to T
FTB63889 15058710 T to G
FTB63890 15067449 A to G
FTB63891 15074989 T to C
FTB63892 15090341 A to G
FTB63893 15091436 A to C
FTB63894 15097169 T to C
FTB63895 15098326 C to A
FTB63896 15098914 T to G
FTB63897 15103853 G to A
FTB63898 15105396 C to G
FTB63899 15111823 C to A
FTB63900 15113307 T to A
FTB63901 15121211 C to A
FTB63902 15126769 A to C
FTB63903 15128858 C to G
FTB63904 15131529 A to G
FTB63905 15132106 C to T
FTB63906 15134182 G to A
FTB63907 15139601 G to A
FTB63908 15161819 C to T
FTB63909 15165272 C to T
FTB63910 15167985 C to T
FTB63911 15169396 G to T
FTB63912 15174025 G to A
FTB63913 15182040 C to G
FTB63914 15187700 C to T
FTB63915 15189061 A to G
FTB63916 15189546 C to T
FTB63917 15194499 T to C
FTB63918 15204614 C to T
FTB63919 15212327 A to G
FTB63920 15217448 A to G
FTB63921 15217951 A to G
FTB63922 15227365 G to T
FTB63923 15231038 T to C
FTB63924 15232621 A to G
FTB63925 15242545 G to A
FTB63926 15248313 C to T
FTB63927 15255545 G to A
FTB63928 15261402 T to A
FTB63929 15263565 C to T
FTB63930 15264480 C to A
FTB63931 15265754 T to A
FTB63932 15266741 C to T
FTB63933 15266921 A to G
FTB63934 15267120 G to A
FTB63935 15269357 C to G
FTB63936 15269728 A to G
FTB63937 15269768 G to A
FTB63938 15272790 G to T
FTB63939 15273482 G to A
FTB63940 15278430 T to C
FTB63941 15281379 C to T
FTB63942 15296227 C to A
FTB63943 15298675 G to A
FTB63944 15300555 C to T
FTB63945 15301748 T to C
FTB63946 15307452 A to G
FTB63947 15309122 G to C
FTB63948 15314663 G to A
FTB63949 15325363 C to A
FTB63950 15325412 C to T
FTB63951 15343218 T to C
FTB63952 15350461 C to A
FTB63953 15356907 G to A
FTB63954 15364574 A to G
FTB63955 15367767 G to A
FTB63956 15372009 C to T
FTB63957 15372363 C to A
FTB63958 15383137 G to A
FTB63959 15383969 A to C
FTB63960 15384409 G to A
FTB63961 15388619 T to C
FTB63962 15389947 A to T
FTB63963 15390249 G to T
FTB63964 15392195 T to G
FTB63965 15393236 C to A
FTB63966 15395177 C to T
FTB63967 15396417 C to T
FTB63968 15396456 C to A
FTB63969 15400563 T to C
FTB63970 15403427 A to T
FTB63971 15417599 T to G
FTB63972 15417602 T to G
FTB63973 15420690 A to G
FTB63974 15433347 G to T
FTB63975 15437677 T to C
FTB63976 15441327 C to T
FTB63977 15449286 T to A
FTB63978 15453235 A to G
FTB63979 15454079 A to C
FTB63980 15454469 A to C
FTB63981 15460510 C to T
FTB63982 15464167 G to A
FTB63983 15466581 C to A
FTB63984 15468920 G to C
FTB63985 15471033 C to A
FTB63986 15479581 G to C
FTB63987 15487309 C to T
FTB63988 15488854 T to C
FTB63989 15491530 G to A
FTB63990 15496224 G to C
FTB63991 15499193 A to G
FTB63992 15501358 C to A
FTB63993 15511214 G to T
FTB63994 15521231 A to G
FTB63995 15521391 A to G
FTB63996 15529983 G to T
FTB63997 15531683 G to A
FTB63998 15535965 T to C
FTB63999 15545105 C to G
FTB64000 15546252 C to A
FTB64001 15553557 A to T
FTB64002 15554940 T to C
FTB64003 15558110 T to A
FTB64004 15566738 T to G
FTB64005 15573975 A to G
FTB64006 15574023 C to T
FTB64007 15581337 C to T
FTB64008 15582374 T to C
FTB64009 15583593 A to T
FTB64010 15584482 G to A
FTB64011 15591958 C to A
FTB64012 15605804 A to C
FTB64013 15611287 G to A
FTB64014 15617584 C to T
FTB64015 15618204 A to C
FTB64016 15626855 T to C
FTB64017 15645391 C to A
FTB64018 15656354 G to A
FTB64019 15658883 T to G
FTB64020 15659972 A to T
FTB64021 15662108 T to C
FTB64022 15663914 T to C
FTB64023 15664741 T to A
FTB64024 15674481 C to G
FTB64025 15675552 T to A
FTB64026 15676031 C to T
FTB64027 15680543 C to T
FTB64028 15680672 G to C
FTB64029 15681214 C to T
FTB64030 15681517 C to T
FTB64031 15681727 T to G
FTB64032 15684720 C to T
FTB64033 15687886 G to C
FTB64034 15691757 T to G
FTB64035 15697146 T to C
FTB64036 15698377 T to G
FTB64037 15699025 C to T
FTB64038 15699857 T to C
FTB64039 15700398 T to G
FTB64040 15701622 T to C
FTB64041 15707893 A to G
FTB64042 15708318 G to T
FTB64043 15709003 A to G
FTB64044 15711818 C to T
FTB64045 15719100 C to G
FTB64046 15719913 G to A
FTB64047 15738501 C to T
FTB64048 15742568 C to T
FTB64049 15758321 C to G
FTB64050 15760190 T to C
FTB64051 15760245 G to T
FTB64052 15765117 C to G
FTB64053 15765946 G to T
FTB64054 15766559 C to T
FTB64055 15772041 T to C
FTB64056 15774155 G to A
FTB64057 15782452 G to T
FTB64058 15782925 G to C
FTB64059 15793094 G to C
FTB64060 15793354 G to T
FTB64061 15794189 G to A
FTB64062 15795817 C to T
FTB64063 15800705 A to C
FTB64064 15802391 T to C
FTB64065 15805961 G to A
FTB64066 15806682 T to A
FTB64067 15809477 A to G
FTB64068 15811862 A to G
FTB64069 15814722 A to G
FTB64070 15814778 C to A
FTB64071 15817334 G to A
FTB64072 15823727 A to G
FTB64073 15827212 G to T
FTB64074 15830289 G to T
FTB64075 15832117 C to T
FTB64076 15833852 A to T
FTB64077 15834806 T to C
FTB64078 15835004 T to C
FTB64079 15836465 A to G
FTB64080 15837688 G to T
FTB64081 15848418 G to A
FTB64082 15852181 G to A
FTB64083 15852915 C to T
FTB64084 15856055 A to G
FTB64085 15869579 G to T
FTB64086 15870939 T to C
FTB64087 15874356 C to A
FTB64088 15894597 C to A
FTB64089 15906090 G to A
FTB64090 15906804 C to A
FTB64091 15908662 G to A
FTB64092 15908953 G to T
FTB64093 15920774 C to G
FTB64094 15927054 T to C
FTB64095 15927749 C to A
FTB64096 15935470 T to C
FTB64097 15936597 T to A
FTB64098 15936633 C to A
FTB64099 15937935 G to C
FTB64100 15938268 C to T
FTB64101 15939933 A to T
FTB64102 15941155 A to C
FTB64103 15942241 C to T
FTB64104 15947176 T to C
FTB64105 15949619 C to T
FTB64106 15951602 C to A
FTB64107 15957444 G to T
FTB64108 15959668 T to C
FTB64109 15961293 T to A
FTB64110 15971588 G to C
FTB64111 15977168 A to G
FTB64112 15981745 C to T
FTB64113 15988535 C to T
FTB64114 15988590 C to T
FTB64115 15990360 G to A
FTB64116 15990909 T to C
FTB64117 15994387 C to A
FTB64118 16004789 T to C
FTB64119 16006224 G to T
FTB64120 16013341 T to C
FTB64121 16017304 G to T
FTB64122 16024309 C to T
FTB64123 16024327 C to G
FTB64124 16024684 G to A
FTB64125 16028211 A to G
FTB64126 16035144 C to G
FTB64127 16037878 G to T
FTB64128 16039072 G to C
FTB64129 16043413 G to T
FTB64130 16054452 C to T
FTB64131 16060189 T to C
FTB64132 16061053 T to G
FTB64133 16066507 T to C
FTB64134 16073861 A to C
FTB64135 16078740 G to A
FTB64136 16080555 A to G
FTB64137 16081398 C to T
FTB64138 16087178 G to C
FTB64139 16088836 T to A
FTB64140 16098882 T to C
FTB64141 16101079 C to A
FTB64142 16111451 G to A
FTB64143 16120356 C to T
FTB64144 16123335 C to T
FTB64145 16124272 G to A
FTB64146 16124273 G to A
FTB64147 16129701 G to C
FTB64148 16133492 C to T
FTB64149 16143520 G to A
FTB64150 16145545 G to A
FTB64151 16148813 G to A
FTB64152 16154328 C to T
FTB64153 16154760 T to C
FTB64154 16155696 G to T
FTB64155 16279825 C to A
FTB64156 16281579 T to G
FTB64157 16284389 G to T
FTB64158 16287052 A to G
FTB64159 16287837 C to A
FTB64160 16290367 C to A
FTB64161 16293810 C to A
FTB64162 16295704 T to A
FTB64163 16297640 G to C
FTB64164 16297668 C to T
FTB64165 16299525 A to G
FTB64166 16300011 C to T
FTB64167 16304077 G to A
FTB64168 16306910 T to G
FTB64169 16307029 C to T
FTB64170 16313187 C to T
FTB64171 16315379 G to A
FTB64172 16426660 G to A
FTB64173 16433204 C to T
FTB64174 16436021 A to G
FTB64175 16436748 G to A
FTB64176 16440790 T to C
FTB64177 16445153 G to T
FTB64178 16448595 T to G
FTB64179 16448916 G to T
FTB64180 16449500 C to T
FTB64181 16453898 G to C
FTB64182 16454265 G to A
FTB64183 16454760 T to C
FTB64184 16457629 A to G
FTB64185 16462138 T to C
FTB64186 16468750 T to A
FTB64187 16468770 G to A
FTB64188 16471158 A to G
FTB64189 16471983 T to C
FTB64190 16473612 C to A
FTB64191 16479328 A to G
FTB64192 16479485 C to T
FTB64193 16485581 A to C
FTB64194 16491740 G to T
FTB64195 16499440 C to T
FTB64196 16505915 G to A
FTB64197 16514960 G to T
FTB64198 16515194 C to A
FTB64199 16516616 C to T
FTB64200 16516632 G to C
FTB64201 16521945 T to A
FTB64202 16522334 C to G
FTB64203 16524576 C to T
FTB64204 16527771 A to G
FTB64205 16539387 G to T
FTB64206 16542643 G to T
FTB64207 16545930 C to A
FTB64208 16551845 T to C
FTB64209 16554528 A to G
FTB64210 16555573 C to T
FTB64211 16556722 T to A
FTB64212 16558214 A to G
FTB64213 16562190 G to T
FTB64214 16564561 C to T
FTB64215 16565877 A to C
FTB64216 16579647 A to G
FTB64217 16581413 T to A
FTB64218 16588363 T to C
FTB64219 16592358 A to C
FTB64220 16593874 C to T
FTB64221 16594713 G to A
FTB64222 16597285 G to C
FTB64223 16597596 C to A
FTB64224 16599344 A to G
FTB64225 16600765 G to A
FTB64226 16610655 C to G
FTB64227 16614053 A to T
FTB64228 16620411 A to T
FTB64229 16624319 T to C
FTB64230 16630953 G to T
FTB64231 16634974 T to C
FTB64232 16635336 G to A
FTB64233 16637232 T to C
FTB64234 16637896 A to G
FTB64235 16647686 T to C
FTB64236 16649421 G to T
FTB64237 16655801 T to C
FTB64238 16657194 A to G
FTB64239 16662070 A to G
FTB64240 16668837 T to C
FTB64241 16669262 A to T
FTB64242 16672561 A to G
FTB64243 16675894 A to G
FTB64244 16676990 C to T
FTB64245 16680294 G to C
FTB64246 16689957 C to A
FTB64247 16690431 C to T
FTB64248 16705732 C to T
FTB64249 16705869 T to G
FTB64250 16706213 A to C
FTB64251 16711014 A to T
FTB64252 16712057 C to T
FTB64253 16714143 C to T
FTB64254 16721391 G to T
FTB64255 16728719 G to C
FTB64256 16742286 C to T
FTB64257 16747351 G to C
FTB64258 16755298 G to A
FTB64259 16758754 C to G
FTB64260 16761376 C to T
FTB64261 16771224 T to C
FTB64262 16774240 A to T
FTB64263 16774318 A to G
FTB64264 16786287 G to A
FTB64265 16791852 G to T
FTB64266 16793049 A to G
FTB64267 16798414 C to A
FTB64268 16811076 G to A
FTB64269 16811198 T to A
FTB64270 16818249 G to C
FTB64271 16822251 A to T
FTB64272 16830447 C to G
FTB64273 16834283 C to T
FTB64274 16838126 A to G
FTB64275 16839556 A to G
FTB64276 16839746 A to G
FTB64277 16843897 C to T
FTB64278 16853394 A to T
FTB64279 16868078 C to G
FTB64280 16872813 C to T
FTB64281 16876699 G to A
FTB64282 16878398 G to T
FTB64283 16878844 A to G
FTB64284 16881173 C to T
FTB64285 16883034 A to G
FTB64286 16890632 G to A
FTB64287 16891561 C to A
FTB64288 16892051 C to A
FTB64289 16894735 A to G
FTB64290 16899970 G to A
FTB64291 16909858 G to A
FTB64292 16909863 G to A
FTB64293 16925000 G to A
FTB64294 16925989 C to T
FTB64295 16927097 C to A
FTB64296 16928670 G to A
FTB64297 16936073 C to A
FTB64298 16938530 A to G
FTB64299 16939493 G to C
FTB64300 16941856 A to G
FTB64301 16942396 T to C
FTB64302 16944059 C to T
FTB64303 16944509 G to A
FTB64304 16946074 T to A
FTB64305 16947441 T to C
FTB64306 16948240 G to T
FTB64307 16950417 C to T
FTB64308 16951503 G to T
FTB64309 16953087 C to A
FTB64310 16953913 G to A
FTB64311 16954499 T to C
FTB64312 16955700 G to A
FTB64313 16958845 C to T
FTB64314 16959048 T to A
FTB64315 16961773 C to T
FTB64316 16964867 G to A
FTB64317 16966358 G to C
FTB64318 16966628 T to C
FTB64319 16967581 T to G
FTB64320 16976386 A to T
FTB64321 16977373 T to C
FTB64322 16978219 C to T
FTB64323 16978327 T to C
FTB64324 16978397 A to G
FTB64325 16979926 G to A
FTB64326 16981018 C to A
FTB64327 16984933 T to G
FTB64328 16995142 T to A
FTB64329 16999682 G to A
FTB64330 17007047 C to T
FTB64331 17007050 T to C
FTB64332 17009301 G to A
FTB64333 17012444 C to T
FTB64334 17017693 G to T
FTB64335 17023579 A to G
FTB64336 17024524 C to A
FTB64337 17030055 T to G
FTB64338 17036914 G to A
FTB64339 17046690 A to G
FTB64340 17047313 G to A
FTB64341 17053788 T to C
FTB64342 17053899 A to T
FTB64343 17056204 C to T
FTB64344 17057126 A to G
FTB64345 17068856 G to T
FTB64346 17069612 T to G
FTB64347 17072306 G to T
FTB64348 17072730 C to T
FTB64349 17078025 T to C
FTB64350 17080182 G to C
FTB64351 17086087 G to A
FTB64352 17091939 T to A
FTB64353 17092927 G to A
FTB64354 17096925 G to A
FTB64355 17099604 T to G
FTB64356 17102128 T to C
FTB64357 17106110 A to G
FTB64358 17108073 T to A
FTB64359 17110024 C to A
FTB64360 17111651 A to T
FTB64361 17118651 A to C
FTB64362 17119096 A to G
FTB64363 17121632 A to G
FTB64364 17123589 C to T
FTB64365 17129866 C to T
FTB64366 17132005 C to T
FTB64367 17138042 C to G
FTB64368 17140589 C to G
FTB64369 17141077 A to C
FTB64370 17142408 C to A
FTB64371 17143032 A to C
FTB64372 17145913 G to A
FTB64373 17149413 T to C
FTB64374 17152528 C to T
FTB64375 17155796 T to C
FTB64376 17156961 A to C
FTB64377 17158003 C to T
FTB64378 17159340 G to C
FTB64379 17162870 A to G
FTB64380 17163549 C to T
FTB64381 17171323 T to G
FTB64382 17184276 C to A
FTB64383 17187329 A to G
FTB64384 17187573 C to A
FTB64385 17188870 T to C
FTB64386 17191221 C to T
FTB64387 17191775 T to G
FTB64388 17194257 C to T
FTB64389 17204200 A to G
FTB64390 17213231 A to G
FTB64391 17222403 G to T
FTB64392 17222636 A to G
FTB64393 17227657 A to T
FTB64394 17232936 T to G
FTB64395 17239075 C to T
FTB64396 17244705 C to T
FTB64397 17248082 A to G
FTB64398 17248908 A to G
FTB64399 17253013 A to G
FTB64400 17270188 C to T
FTB64401 17280651 A to G
FTB64402 17283464 T to C
FTB64403 17286336 C to T
FTB64404 17297541 A to G
FTB64405 17299365 A to G
FTB64406 17304778 C to T
FTB64407 17306510 G to A
FTB64408 17307438 T to A
FTB64409 17311744 C to G
FTB64410 17318024 T to C
FTB64411 17319583 T to C
FTB64412 17325449 G to A
FTB64413 17329470 C to T
FTB64414 17330746 C to T
FTB64415 17331135 T to C
FTB64416 17331407 G to A
FTB64417 17331436 G to T
FTB64418 17344950 T to C
FTB64419 17348195 G to C
FTB64420 17350906 G to C
FTB64421 17351086 C to T
FTB64422 17353416 G to C
FTB64423 17358143 G to A
FTB64424 17358480 T to C
FTB64425 17366171 G to T
FTB64426 17367912 T to C
FTB64427 17368873 C to T
FTB64428 17370079 T to A
FTB64429 17372125 T to A
FTB64430 17373745 C to A
FTB64431 17377770 G to A
FTB64432 17385234 G to A
FTB64433 17387227 A to C
FTB64434 17392251 G to C
FTB64435 17396252 T to A
FTB64436 17396280 A to G
FTB64437 17396501 G to A
FTB64438 17397361 T to A
FTB64439 17414482 T to G
FTB64440 17421031 A to C
FTB64441 17422470 T to C
FTB64442 17427772 T to G
FTB64443 17434615 C to G
FTB64444 17436402 G to A
FTB64445 17439156 C to T
FTB64446 18642686 T to A
FTB64447 18654492 A to T
FTB64448 18656633 A to C
FTB64449 18656703 T to A
FTB64450 18663678 G to A
FTB64451 18667040 G to T
FTB64452 18667644 C to G
FTB64453 18674901 G to A
FTB64454 18677506 C to T
FTB64455 18878253 T to C
FTB64456 18883274 G to A
FTB64457 18883418 C to T
FTB64458 18892831 T to C
FTB64459 18894576 C to T
FTB64460 18904486 G to A
FTB64461 18905759 C to T
FTB64462 18908383 C to G
FTB64463 18909658 A to C
FTB64464 18911181 A to G
FTB64465 18917313 C to A
FTB64466 18917326 T to C
FTB64467 18920012 G to A
FTB64468 18922769 C to T
FTB64469 18943763 G to A
FTB64470 18947391 G to T
FTB64471 18952191 A to G
FTB64472 18954132 C to T
FTB64473 18956442 A to G
FTB64474 18964054 T to C
FTB64475 18969734 C to T
FTB64476 18970003 T to C
FTB64477 18970942 C to T
FTB64478 18974117 T to A
FTB64479 18974118 G to C
FTB64480 18974119 T to A
FTB64481 18974352 T to G
FTB64482 18988157 T to C
FTB64483 19002639 A to G
FTB64484 19015110 T to G
FTB64485 19016847 G to C
FTB64486 19018444 A to T
FTB64487 19026733 C to T
FTB64488 19031457 T to A
FTB64489 19034749 A to G
FTB64490 19040225 A to T
FTB64491 19046862 G to C
FTB64492 19053644 A to G
FTB64493 19056368 A to G
FTB64494 19061545 A to C
FTB64495 19064672 G to C
FTB64496 19065533 T to G
FTB64497 19070429 A to G
FTB64498 19072106 G to A
FTB64499 19076001 C to A
FTB64500 19079151 C to T
FTB64501 19083747 G to A
FTB64502 19086520 G to A
FTB64503 19088756 A to T
FTB64504 19089621 T to C
FTB64505 19092152 G to A
FTB64506 19092480 T to G
FTB64507 19092942 T to C
FTB64508 19097047 G to C
FTB64509 19097425 C to T
FTB64510 19098014 C to A
FTB64511 19103464 T to C
FTB64512 19103891 G to A
FTB64513 19104063 G to T
FTB64514 19107081 A to G
FTB64515 19113737 A to G
FTB64516 19114520 G to C
FTB64517 19116183 T to G
FTB64518 19121896 T to C
FTB64519 19122337 A to G
FTB64520 19126560 G to C
FTB64521 19127702 C to T
FTB64522 19129157 T to C
FTB64523 19129458 T to A
FTB64524 19137603 A to C
FTB64525 19145667 C to G
FTB64526 19146482 G to T
FTB64527 19151095 C to T
FTB64528 19151447 C to A
FTB64529 19152157 C to G
FTB64530 19154762 A to T
FTB64531 19155356 G to A
FTB64532 19160667 G to A
FTB64533 19167903 C to T
FTB64534 19169216 A to C
FTB64535 19169629 T to C
FTB64536 19178806 C to A
FTB64537 19181837 G to A
FTB64538 19195404 C to T
FTB64539 19195684 C to A
FTB64540 19198830 C to T
FTB64541 19201947 A to G
FTB64542 19208819 A to G
FTB64543 19212363 T to C
FTB64544 19221835 T to A
FTB64545 19227782 C to A
FTB64546 19236660 A to T
FTB64547 19239365 T to C
FTB64548 19241911 T to A
FTB64549 19243929 C to G
FTB64550 19246220 T to A
FTB64551 19247759 C to T
FTB64552 19249441 T to C
FTB64553 19252140 A to G
FTB64554 19269947 C to T
FTB64555 19278811 G to A
FTB64556 19290422 A to G
FTB64557 19291530 A to G
FTB64558 19302460 C to A
FTB64559 19303949 T to C
FTB64560 19305551 A to G
FTB64561 19305655 A to T
FTB64562 19324140 T to C
FTB64563 19329192 C to G
FTB64564 19335629 A to G
FTB64565 19340746 G to T
FTB64566 19347929 A to G
FTB64567 19349187 T to C
FTB64568 19349842 A to G
FTB64569 19354614 G to C
FTB64570 19360454 A to C
FTB64571 19370009 G to A
FTB64572 19370095 T to A
FTB64573 19371019 A to G
FTB64574 19372286 G to A
FTB64575 19377389 C to T
FTB64576 19382971 C to T
FTB64577 19383074 A to G
FTB64578 19391435 T to C
FTB64579 19394251 T to C
FTB64580 19403982 G to A
FTB64581 19403993 A to T
FTB64582 19406438 T to G
FTB64583 19408967 C to A
FTB64584 19426659 T to G
FTB64585 19432101 T to C
FTB64586 19433540 C to T
FTB64587 19436457 T to A
FTB64588 19442336 T to C
FTB64589 19445810 C to G
FTB64590 19447227 G to C
FTB64591 19449398 A to G
FTB64592 19456225 G to A
FTB64593 19457418 T to C
FTB64594 19461105 A to C
FTB64595 19461288 T to G
FTB64596 19482276 T to A
FTB64597 19489906 C to T
FTB64598 19490126 A to G
FTB64599 19491170 T to C
FTB64600 19510055 G to A
FTB64601 19510675 T to A
FTB64602 19530748 G to C
FTB64603 19535188 T to G
FTB64604 19556003 A to G
FTB64605 19559568 C to A
FTB64606 19576143 C to T
FTB64607 19577656 C to T
FTB64608 19577806 C to T
FTB64609 19580186 G to C
FTB64610 19587892 T to C
FTB64611 19598063 A to G
FTB64612 19605583 C to T
FTB64613 19605974 A to G
FTB64614 19607229 T to C
FTB64615 19613221 C to T
FTB64616 19614346 A to C
FTB64617 19617641 G to A
FTB64618 19617843 C to T
FTB64619 19622338 G to A
FTB64620 19623474 A to G
FTB64621 19629408 C to T
FTB64622 19634942 T to G
FTB64623 19635195 T to C
FTB64624 19637396 G to T
FTB64625 19651156 A to G
FTB64626 19653800 G to C
FTB64627 19655088 C to T
FTB64628 19658587 G to C
FTB64629 19659617 C to T
FTB64630 19660092 C to G
FTB64631 19662543 C to T
FTB64632 19668370 G to A
FTB64633 19670468 G to T
FTB64634 19670923 C to A
FTB64635 19670998 A to T
FTB64636 19672818 T to A
FTB64637 19674274 G to A
FTB64638 19680310 T to G
FTB64639 19687203 G to A
FTB64640 19689473 T to A
FTB64641 19690806 T to C
FTB64642 19691738 A to C
FTB64643 19702758 T to C
FTB64644 19705470 A to T
FTB64645 19717462 A to T
FTB64646 19719409 T to C
FTB64647 19722363 T to C
FTB64648 19726467 G to A
FTB64649 19726868 C to T
FTB64650 19727754 A to G
FTB64651 19732847 T to C
FTB64652 19733405 A to G
FTB64653 19734000 A to G
FTB64654 19736875 A to G
FTB64655 19745146 G to T
FTB64656 19745654 A to G
FTB64657 19753954 C to T
FTB64658 19768311 A to G
FTB64659 19770030 T to G
FTB64660 19771722 A to G
FTB64661 19772756 A to G
FTB64662 19773878 C to G
FTB64663 19776282 T to C
FTB64664 19779035 C to T
FTB64665 19784289 T to A
FTB64666 19790185 G to T
FTB64667 19797621 T to G
FTB64668 19798414 G to A
FTB64669 19809108 C to T
FTB64670 19809552 G to T
FTB64671 19810348 T to C
FTB64672 19812054 G to T
FTB64673 19819757 C to A
FTB64674 19824698 C to T
FTB64675 19826627 C to T
FTB64676 19829768 T to C
FTB64677 19833756 T to C
FTB64678 19838566 C to A
FTB64679 19841523 G to T
FTB64680 19844727 C to G
FTB64681 19846740 C to A
FTB64682 19848621 C to T
FTB64683 19854853 C to G
FTB64684 19861282 A to G
FTB64685 19861284 T to A
FTB64686 19862401 T to C
FTB64687 19862681 T to G
FTB64688 19866306 T to C
FTB64689 19868309 T to C
FTB64690 19869561 T to G
FTB64691 19872161 G to A
FTB64692 19872221 C to T
FTB64693 19874751 A to G
FTB64694 19876864 G to A
FTB64695 19882267 C to T
FTB64696 19886620 C to T
FTB64697 19887239 C to A
FTB64698 19887241 T to A
FTB64699 19889252 T to C
FTB64700 19889858 T to A
FTB64701 19894519 C to T
FTB64702 19902254 C to A
FTB64703 19907140 A to C
FTB64704 19911371 C to T
FTB64705 19914103 C to T
FTB64706 19916669 T to A
FTB64707 19925057 G to A
FTB64708 19931265 C to A
FTB64709 19940948 A to G
FTB64710 19945211 A to C
FTB64711 19945585 T to C
FTB64712 19967012 T to C
FTB64713 19968884 C to G
FTB64714 19982463 T to A
FTB64715 19984426 T to C
FTB64716 19987729 G to A
FTB64717 19994259 C to T
FTB64718 19996320 C to A
FTB64719 19996546 T to A
FTB64720 20004681 G to A
FTB64721 20006372 C to T
FTB64722 20009189 C to T
FTB64723 20010880 G to A
FTB64724 20011694 C to A
FTB64725 20021448 T to C
FTB64726 20022519 C to A
FTB64727 20023736 A to G
FTB64728 20024704 T to A
FTB64729 20028927 C to T
FTB64730 20031796 A to T
FTB64731 20037564 G to A
FTB64732 20043959 T to A
FTB64733 20044522 T to C
FTB64734 20044758 A to G
FTB64735 20044838 T to A
FTB64736 20052700 C to T
FTB64737 20358056 C to T
FTB64738 20358268 G to C
FTB64739 20359168 G to T
FTB64740 20374015 A to G
FTB64741 20377317 C to T
FTB64742 20378578 G to T
FTB64743 20389507 A to G
FTB64744 20395337 C to A
FTB64745 20401776 C to T
FTB64746 20402686 C to A
FTB64747 20402980 A to G
FTB64748 20406321 C to T
FTB64749 20406937 T to A
FTB64750 20407315 T to C
FTB64751 20407591 C to T
FTB64752 20409871 C to T
FTB64753 20412970 G to T
FTB64754 20413459 T to A
FTB64755 20414434 T to C
FTB64756 20418876 A to G
FTB64757 20418915 A to T
FTB64758 20422065 T to A
FTB64759 20422340 T to G
FTB64760 20429730 C to G
FTB64761 20435797 C to G
FTB64762 20435959 C to A
FTB64763 20436178 C to T
FTB64764 20436755 G to T
FTB64765 20437115 A to T
FTB64766 20437661 A to G
FTB64767 20439024 A to G
FTB64768 20465335 T to C
FTB64769 20470826 G to A
FTB64770 20471041 C to T
FTB64771 20472161 A to G
FTB64772 20472208 C to G
FTB64773 20489001 G to A
FTB64774 20489795 C to A
FTB64775 20490032 C to G
FTB64776 20493758 C to G
FTB64777 20494273 A to G
FTB64778 20496733 C to A
FTB64779 20498105 G to A
FTB64780 20500218 A to G
FTB64781 20503155 A to G
FTB64782 20505897 G to T
FTB64783 20520232 C to G
FTB64784 20536269 T to C
FTB64785 20537200 T to G
FTB64786 20548416 C to A
FTB64787 20552613 C to A
FTB64788 20554716 G to T
FTB64789 20554912 A to G
FTB64790 20555468 T to G
FTB64791 20561271 G to A
FTB64792 20561816 T to C
FTB64793 20574094 A to C
FTB64794 20582345 G to T
FTB64795 20584225 A to G
FTB64796 20584652 A to T
FTB64797 20592243 G to T
FTB64798 20596153 A to G
FTB64799 20596987 G to A
FTB64800 20609972 G to A
FTB64801 20610869 A to G
FTB64802 20629586 G to A
FTB64803 20631620 A to T
FTB64804 20633102 T to C
FTB64805 20636334 G to T
FTB64806 20647206 T to G
FTB64807 20650356 T to C
FTB64808 20664219 G to A
FTB64809 20668633 T to C
FTB64810 20670600 A to C
FTB64811 20672380 T to C
FTB64812 20672993 A to G
FTB64813 20674535 G to A
FTB64814 20677694 C to G
FTB64815 20678325 C to T
FTB64816 20684456 G to A
FTB64817 20684460 G to A
FTB64818 20684630 C to T
FTB64819 20688691 A to G
FTB64820 20689043 C to G
FTB64821 20693313 G to T
FTB64822 20694487 C to T
FTB64823 20704353 A to G
FTB64824 20709208 C to T
FTB64825 20712395 C to T
FTB64826 20713556 G to A
FTB64827 20717662 A to G
FTB64828 20725258 G to C
FTB64829 20726464 C to A
FTB64830 20727282 T to C
FTB64831 20727529 C to T
FTB64832 20728568 T to C
FTB64833 20729552 G to A
FTB64834 20731503 T to G
FTB64835 20736442 G to C
FTB64836 20741072 C to T
FTB64837 20744279 G to A
FTB64838 20746315 G to T
FTB64839 20749377 C to A
FTB64840 20750794 C to G
FTB64841 20750987 T to C
FTB64842 20772185 G to T
FTB64843 20773937 C to T
FTB64844 20777961 C to T
FTB64845 20783838 C to G
FTB64846 20786334 T to C
FTB64847 20791716 G to T
FTB64848 20799197 A to T
FTB64849 20800038 G to A
FTB64850 20816160 A to G
FTB64851 20818169 G to A
FTB64852 20819030 C to A
FTB64853 20829342 G to T
FTB64854 20829572 A to G
FTB64855 20829899 A to G
FTB64856 20832036 G to A
FTB64857 20832676 G to A
FTB64858 20844269 C to G
FTB64859 20847077 C to T
FTB64860 20858092 C to T
FTB64861 20858688 C to T
FTB64862 20862529 C to A
FTB64863 20871903 C to T
FTB64864 20876197 G to T
FTB64865 20879658 G to A
FTB64866 20885210 G to A
FTB64867 20887762 T to A
FTB64868 20888141 C to A
FTB64869 20890685 G to T
FTB64870 20890822 A to T
FTB64871 20894225 G to A
FTB64872 20901422 C to A
FTB64873 20902896 T to C
FTB64874 20904857 C to A
FTB64875 20905217 G to T
FTB64876 20905533 C to A
FTB64877 20911392 T to G
FTB64878 20912027 C to A
FTB64879 20917350 A to G
FTB64880 20919117 T to A
FTB64881 20931782 A to G
FTB64882 20937288 A to G
FTB64883 20949875 G to C
FTB64884 20949913 T to G
FTB64885 20955649 T to C
FTB64886 20957696 C to T
FTB64887 20963648 G to C
FTB64888 20964844 C to T
FTB64889 20964993 C to G
FTB64890 20967120 G to A
FTB64891 20972462 C to G
FTB64892 20975463 C to T
FTB64893 20980394 A to C
FTB64894 20980541 T to A
FTB64895 20982915 T to C
FTB64896 20984948 C to G
FTB64897 20989099 T to A
FTB64898 20989545 G to C
FTB64899 20995252 A to T
FTB64900 20998434 A to G
FTB64901 21000247 G to C
FTB64902 21003362 G to A
FTB64903 21004336 G to A
FTB64904 21005992 C to A
FTB64905 21012368 C to T
FTB64906 21025157 C to G
FTB64907 21037581 G to C
FTB64908 21038397 C to A
FTB64909 21041856 T to C
FTB64910 21042478 G to A
FTB64911 21046873 G to A
FTB64912 21068574 C to G
FTB64913 21074181 A to C
FTB64914 21075377 G to A
FTB64915 21083684 A to T
FTB64916 21083723 G to A
FTB64917 21086302 C to T
FTB64918 21089046 C to G
FTB64919 21089702 G to T
FTB64920 21099184 A to C
FTB64921 21100160 G to C
FTB64922 21105803 G to A
FTB64923 21110246 T to C
FTB64924 21115098 G to A
FTB64925 21115637 T to C
FTB64926 21120558 A to G
FTB64927 21122437 A to G
FTB64928 21135659 G to C
FTB64929 21137343 A to C
FTB64930 21144956 G to C
FTB64931 21145977 G to A
FTB64932 21148462 A to T
FTB64933 21152566 T to C
FTB64934 21155454 G to C
FTB64935 21160635 C to T
FTB64936 21161503 G to C
FTB64937 21162621 T to C
FTB64938 21163929 T to A
FTB64939 21165059 G to A
FTB64940 21174077 T to C
FTB64941 21180916 C to T
FTB64942 21194251 G to A
FTB64943 21194563 C to T
FTB64944 21202933 C to T
FTB64945 21205911 A to G
FTB64946 21206767 C to A
FTB64947 21208393 G to C
FTB64948 21217542 C to A
FTB64949 21219023 A to C
FTB64950 21220683 T to C
FTB64951 21234634 G to T
FTB64952 21237140 T to C
FTB64953 21245016 A to G
FTB64954 21253387 A to G
FTB64955 21261907 T to C
FTB64956 21265471 A to C
FTB64957 21265551 G to A
FTB64958 21269393 C to G
FTB64959 21269822 C to G
FTB64960 21275322 A to G
FTB64961 21278492 T to C
FTB64962 21279657 A to C
FTB64963 21284089 G to C
FTB64964 21291004 C to G
FTB64965 21296904 G to T
FTB64966 21299031 A to T
FTB64967 21299066 G to A
FTB64968 21302514 A to G
FTB64969 21304529 G to C
FTB64970 21306004 C to G
FTB64971 21319264 T to G
FTB64972 21324949 C to G
FTB64973 21326605 T to C
FTB64974 21332962 T to C
FTB64975 21340878 G to C
FTB64976 21345428 T to C
FTB64977 21348631 C to A
FTB64978 21369595 C to A
FTB64979 21371066 A to G
FTB64980 21375967 A to C
FTB64981 21383145 T to C
FTB64982 21384405 G to C
FTB64983 21393459 C to T
FTB64984 21396285 T to C
FTB64985 21398133 G to C
FTB64986 21403105 C to G
FTB64987 21403106 T to A
FTB64988 21403109 A to C
FTB64989 21405742 G to T
FTB64990 21410749 T to G
FTB64991 21414110 C to T
FTB64992 21418252 A to G
FTB64993 21418932 G to A
FTB64994 21420637 T to A
FTB64995 21421549 G to A
FTB64996 21444439 T to G
FTB64997 21444617 G to T
FTB64998 21446846 C to T
FTB64999 21453369 G to A
FTB65000 21456047 T to G
FTB65001 21460729 A to G
FTB65002 21471365 C to A
FTB65003 21472825 C to T
FTB65004 21474169 G to C
FTB65005 21586625 A to G
FTB65006 21586634 A to G
FTB65007 21601197 T to C
FTB65008 21609257 G to A
FTB65009 21610122 A to C
FTB65010 21618011 C to A
FTB65011 21618625 T to C
FTB65012 21620750 C to T
FTB65013 21623541 T to C
FTB65014 21624678 G to C
FTB65015 21624788 C to T
FTB65016 21625132 T to A
FTB65017 21626312 C to T
FTB65018 21627115 G to T
FTB65019 21628452 T to C
FTB65020 21631387 T to G
FTB65021 21632660 C to T
FTB65022 21633699 G to T
FTB65023 21635297 G to A
FTB65024 21640904 A to T
FTB65025 21647464 C to A
FTB65026 21649004 C to A
FTB65027 21650468 C to T
FTB65028 21657395 G to A
FTB65029 21658337 G to T
FTB65030 21660591 T to G
FTB65031 21660912 G to C
FTB65032 21663318 C to T
FTB65033 21663504 A to G
FTB65034 21664036 A to G
FTB65035 21670274 G to A
FTB65036 21673272 A to G
FTB65037 21679371 A to T
FTB65038 21683954 A to G
FTB65039 21699014 G to A
FTB65040 21707475 A to C
FTB65041 21708653 C to A
FTB65042 21813281 G to A
FTB65043 21816886 C to A
FTB65044 21823371 G to A
FTB65045 21839451 C to T
FTB65046 21845257 G to A
FTB65047 22232327 A to C
FTB65048 22235634 A to G
FTB65049 22242396 A to G
FTB65050 22246342 T to C
FTB65051 22249078 A to G
FTB65052 22251603 G to A
FTB65053 22254649 T to G
FTB65054 22254799 C to T
FTB65055 22255690 G to A
FTB65056 22256877 A to G
FTB65057 22259129 C to T
FTB65058 22261764 C to A
FTB65059 22264920 G to A
FTB65060 22264991 C to T
FTB65061 22268928 A to C
FTB65062 22286683 T to A
FTB65063 22291270 C to G
FTB65064 22291817 C to A
FTB65065 22291878 A to G
FTB65066 22296717 C to T
FTB65067 22305902 T to C
FTB65068 22309384 T to C
FTB65069 22312869 A to G
FTB65070 22313235 T to G
FTB65071 22314039 T to C
FTB65072 22315074 A to C
FTB65073 22317607 T to C
FTB65074 22318746 G to A
FTB65075 22331281 C to T
FTB65076 26312877 T to C
FTB65077 26314029 C to G
FTB65078 26318994 A to C
FTB65079 26319855 G to T
FTB65080 26320482 T to C
FTB65081 26322351 C to T
FTB65082 26323776 A to C
FTB65083 26324253 G to C
FTB65084 26326024 T to A
FTB65085 26331615 C to T
FTB65086 26333404 C to T
FTB65087 26339171 T to G
FTB65088 26350016 G to C
FTB65089 26350991 T to C
FTB65090 26355660 T to C
FTB65091 26366844 A to G
FTB65092 26368144 C to T
FTB65093 26372095 C to A
FTB65094 26374587 G to T
FTB65095 26378293 A to T
FTB65096 26381109 T to C
FTB65097 26386032 G to A
FTB65098 26390188 T to C
FTB65099 26391692 T to G
FTB65100 26393217 A to T
FTB65101 26400561 C to A
FTB65102 26400594 G to T
FTB65103 26404348 G to A
FTB65104 26405602 C to A
FTB65105 26425633 C to T
FTB65106 26426925 C to A
FTB65107 26427451 T to C
FTB65108 26446430 T to A
FTB65109 26451372 A to G
FTB65110 26452232 A to T
FTB65111 26452379 A to T
FTB65112 26459905 C to T
FTB65113 26462224 C to T
FTB65114 26472361 C to T
FTB65115 26474900 A to T
FTB65116 26475901 C to G
FTB65117 26479632 T to C
FTB65118 26480877 C to T
FTB65119 26481643 G to A
FTB65120 26483393 C to A
FTB65121 26484624 C to T
FTB65122 26497372 G to A
FTB65123 26502435 T to C
FTB65124 26503136 C to T
FTB65125 26506809 C to T
FTB65126 26511259 A to C
FTB65127 26513419 T to C
FTB65128 26516544 T to G
FTB65129 26521431 G to A
FTB65130 26524395 T to A
FTB65131 26533260 C to T
FTB65132 26535111 C to A
FTB65133 26535652 A to G
FTB65134 26545761 A to T
FTB65135 26555121 G to A
FTB65136 26560354 C to A
FTB65137 26563047 C to A
FTB65138 26565748 G to T
FTB65139 26580772 T to C
FTB65140 26584048 C to A
FTB65141 26590826 G to C
FTB65142 26592591 C to T
FTB65143 26593750 C to T
FTB65144 26596024 A to G
FTB65145 26609139 C to T
FTB65146 26613053 A to G
FTB65147 26614189 C to T
FTB65148 26616490 C to A
FTB65149 26619627 T to C
FTB65150 26621802 C to T
FTB65151 26623116 G to C
FTB65152 2787781 C to T
FTB65153 3046334 A to G
FTB65154 3047303 G to A
FTB65155 3063953 T to C
FTB65156 3068289 T to A
FTB65157 3093568 G to A
FTB65158 3096093 A to G
FTB65159 3099190 G to A
FTB65160 3100039 T to C
FTB65161 3104935 T to G
FTB65162 3106038 C to T
FTB65163 3111631 T to G
FTB65164 3128910 C to G
FTB65165 3131469 A to G
FTB65166 3132956 G to A
FTB65167 3135432 A to G
FTB65168 3143558 C to A
FTB65169 3151410 T to G
FTB65170 3172403 C to T
FTB65171 3178170 A to G
FTB65172 3188874 G to T
FTB65173 3189606 C to G
FTB65174 3189669 A to C
FTB65175 3192133 G to A
FTB65176 3211736 C to T
FTB65177 3213867 A to G
FTB65178 3226762 A to G
FTB65179 3227127 A to C
FTB65180 3241862 C to G
FTB65181 3242496 C to G
FTB65182 3244653 T to C
FTB65183 3249452 T to G
FTB65184 3252618 T to C
FTB65185 3255620 A to C
FTB65186 3278200 A to G
FTB65187 3284069 T to C
FTB65188 3284320 G to A
FTB65189 3286035 T to C
FTB65190 3289558 A to G
FTB65191 3290086 T to G
FTB65192 3296938 T to C
FTB65193 3300642 C to T
FTB65194 3300792 T to C
FTB65195 3325160 T to C
FTB65196 3328016 T to G
FTB65197 3332120 A to G
FTB65198 3341784 G to C
FTB65199 3347660 A to T
FTB65200 3348956 T to G
FTB65201 3356072 T to C
FTB65202 3358379 T to G
FTB65203 3360541 A to G
FTB65204 3363936 C to A
FTB65205 3364069 C to T
FTB65206 3365899 A to T
FTB65207 3366288 C to T
FTB65208 3371306 T to C
FTB65209 3372596 G to A
FTB65210 3386926 A to G
FTB65211 3387699 C to G
FTB65212 3393572 T to A
FTB65213 3393847 A to G
FTB65214 3396449 T to C
FTB65215 3397816 C to T
FTB65216 3405131 G to A
FTB65217 3411408 G to A
FTB65218 3417541 A to G
FTB65219 3417634 C to G
FTB65220 3426206 T to G
FTB65221 3431489 A to G
FTB65222 3436099 C to T
FTB65223 3437569 A to T
FTB65224 3442092 A to G
FTB65225 3453010 G to A
FTB65226 3453017 G to T
FTB65227 3458519 A to G
FTB65228 3459919 T to C
FTB65229 3465139 C to A
FTB65230 3469802 C to A
FTB65231 3471853 T to A
FTB65232 3478363 C to T
FTB65233 3483992 G to T
FTB65234 3487372 C to T
FTB65235 3493774 C to T
FTB65236 3507998 C to T
FTB65237 3510950 G to T
FTB65238 3518655 A to G
FTB65239 3525547 T to C
FTB65240 3526330 C to G
FTB65241 3526333 T to C
FTB65242 3526346 C to T
FTB65243 3542692 A to T
FTB65244 3544164 T to C
FTB65245 3559856 G to A
FTB65246 3566769 A to G
FTB65247 3566978 A to T
FTB65248 3568944 A to T
FTB65249 3572438 A to C
FTB65250 3575396 T to C
FTB65251 3581048 C to T
FTB65252 3581071 C to G
FTB65253 3586930 T to C
FTB65254 3603686 T to A
FTB65255 3609670 T to C
FTB65256 3610888 C to T
FTB65257 3613973 A to T
FTB65258 3617378 G to A
FTB65259 3626329 A to T
FTB65260 3626834 C to G
FTB65261 3627542 C to T
FTB65262 3633446 T to C
FTB65263 3634621 G to T
FTB65264 3636639 G to A
FTB65265 3643154 G to C
FTB65266 3646557 G to A
FTB65267 3654460 T to C
FTB65268 3655130 T to C
FTB65269 3656336 A to G
FTB65270 3658771 G to A
FTB65271 3664953 C to T
FTB65272 3668138 G to A
FTB65273 3669378 G to A
FTB65274 3677264 T to G
FTB65275 3681761 G to A
FTB65276 3683346 T to C
FTB65277 3684063 T to C
FTB65278 3684581 G to T
FTB65279 3686570 T to C
FTB65280 3688732 T to C
FTB65281 3693439 G to A
FTB65282 3697586 T to G
FTB65283 3703706 T to C
FTB65284 3734912 A to G
FTB65285 3738505 G to C
FTB65286 3738966 T to G
FTB65287 3741854 G to A
FTB65288 3773145 T to A
FTB65289 3777301 G to T
FTB65290 3790541 G to A
FTB65291 3794922 A to G
FTB65292 3796675 T to C
FTB65293 3802666 C to T
FTB65294 3806689 G to A
FTB65295 3827007 C to T
FTB65296 3832197 T to C
FTB65297 3839056 C to T
FTB65298 3840935 G to A
FTB65299 3843067 C to T
FTB65300 3855801 A to C
FTB65301 3865455 C to G
FTB65302 3866912 T to C
FTB65303 3878323 A to G
FTB65304 3878819 C to G
FTB65305 3880453 G to A
FTB65306 3881060 G to T
FTB65307 3886143 C to G
FTB65308 3901050 G to T
FTB65309 3904010 C to T
FTB65310 3912355 C to T
FTB65311 3912961 G to A
FTB65312 3913299 G to A
FTB65313 3916247 G to A
FTB65314 3923010 G to C
FTB65315 3924300 C to G
FTB65316 3925631 G to A
FTB65317 3934155 C to T
FTB65318 3945539 G to A
FTB65319 3948902 C to T
FTB65320 3954823 A to G
FTB65321 3956701 T to C
FTB65322 3957900 A to G
FTB65323 3963218 A to C
FTB65324 3965520 A to T
FTB65325 3966273 A to T
FTB65326 3974153 C to T
FTB65327 3978966 T to C
FTB65328 3980473 T to C
FTB65329 3986652 C to A
FTB65330 3992758 G to A
FTB65331 4013455 G to C
FTB65332 4014694 A to G
FTB65333 4014766 C to A
FTB65334 4019528 G to A
FTB65335 4033231 T to C
FTB65336 4033316 A to T
FTB65337 4036072 T to A
FTB65338 4043776 A to G
FTB65339 4053906 G to T
FTB65340 4054936 C to T
FTB65341 4056566 C to A
FTB65342 4064598 A to G
FTB65343 4065322 C to T
FTB65344 4069351 A to C
FTB65345 4074835 G to A
FTB65346 4078066 C to T
FTB65347 4078438 C to G
FTB65348 4083407 C to T
FTB65349 4087395 T to G
FTB65350 4096344 A to T
FTB65351 4102509 A to G
FTB65352 4103632 G to A
FTB65353 4118327 C to T
FTB65354 4125314 G to C
FTB65355 4129509 A to G
FTB65356 4135314 G to A
FTB65357 4135405 C to T
FTB65358 4140193 T to C
FTB65359 4143708 C to A
FTB65360 4146278 A to G
FTB65361 4151777 C to G
FTB65362 4157856 A to G
FTB65363 4168795 T to C
FTB65364 4171064 A to G
FTB65365 4172150 G to A
FTB65366 4174301 T to G
FTB65367 4177256 T to C
FTB65368 4183359 T to C
FTB65369 4186049 A to C
FTB65370 4186060 G to A
FTB65371 4189385 G to A
FTB65372 4190311 C to A
FTB65373 4194862 T to A
FTB65374 4195585 C to A
FTB65375 4196073 C to T
FTB65376 4201757 A to T
FTB65377 4207818 C to A
FTB65378 4217000 A to C
FTB65379 4226452 A to G
FTB65380 4242562 C to G
FTB65381 4244330 A to G
FTB65382 4251072 G to A
FTB65383 4255033 A to G
FTB65384 4260392 T to C
FTB65385 4272851 A to G
FTB65386 4275114 A to C
FTB65387 4276247 T to G
FTB65388 4283553 A to G
FTB65389 4286450 A to G
FTB65390 4289797 T to C
FTB65391 4292139 G to T
FTB65392 4292961 C to T
FTB65393 4301458 T to A
FTB65394 4302948 T to C
FTB65395 4322662 C to G
FTB65396 4328484 T to A
FTB65397 4334904 A to T
FTB65398 4338519 C to T
FTB65399 4342498 C to T
FTB65400 4363826 C to A
FTB65401 4364633 A to G
FTB65402 4365246 A to G
FTB65403 4371547 T to C
FTB65404 4371934 C to T
FTB65405 4374855 C to A
FTB65406 4375310 A to G
FTB65407 4391395 G to A
FTB65408 4391594 T to C
FTB65409 4393943 A to G
FTB65410 4408057 T to A
FTB65411 4428848 T to C
FTB65412 4431114 C to T
FTB65413 4441156 G to A
FTB65414 4446429 A to T
FTB65415 4448308 C to A
FTB65416 4448990 T to A
FTB65417 4450893 A to T
FTB65418 4455380 A to G
FTB65419 4465261 C to G
FTB65420 4465872 T to A
FTB65421 4468953 C to T
FTB65422 4473316 C to G
FTB65423 4480199 G to T
FTB65424 4480655 A to G
FTB65425 4481070 A to G
FTB65426 4482212 T to C
FTB65427 4485681 C to G
FTB65428 4493491 G to C
FTB65429 4495990 G to C
FTB65430 4499588 G to A
FTB65431 4499866 T to C
FTB65432 4501803 A to G
FTB65433 4502989 T to C
FTB65434 4505138 T to G
FTB65435 4507253 G to T
FTB65436 4509536 A to G
FTB65437 4512502 T to C
FTB65438 4513525 C to T
FTB65439 4515373 A to T
FTB65440 4519993 T to C
FTB65441 4521586 C to A
FTB65442 4521882 C to T
FTB65443 4523942 G to A
FTB65444 4534312 G to A
FTB65445 4537834 A to T
FTB65446 4545792 A to G
FTB65447 4549407 G to A
FTB65448 4549636 A to G
FTB65449 4553302 G to A
FTB65450 4553389 T to G
FTB65451 4557800 A to G
FTB65452 4573361 A to T
FTB65453 4575185 A to G
FTB65454 4578484 C to T
FTB65455 4579380 A to C
FTB65456 4581259 G to A
FTB65457 4582392 C to T
FTB65458 4595476 C to T
FTB65459 4600079 C to T
FTB65460 4605458 T to A
FTB65461 4609135 T to G
FTB65462 4610714 A to G
FTB65463 4620690 C to G
FTB65464 4623581 C to T
FTB65465 4626460 A to C
FTB65466 4629281 C to A
FTB65467 4636097 G to A
FTB65468 4642962 A to C
FTB65469 4643350 C to T
FTB65470 4650588 A to G
FTB65471 4651142 T to C
FTB65472 4652403 G to A
FTB65473 4655166 T to A
FTB65474 4669095 C to G
FTB65475 4671205 G to A
FTB65476 4672683 A to G
FTB65477 4677403 G to A
FTB65478 4680905 G to A
FTB65479 4683939 C to G
FTB65480 4689926 A to G
FTB65481 4698161 A to G
FTB65482 4702417 G to C
FTB65483 4703318 A to C
FTB65484 4705568 A to G
FTB65485 4708016 G to C
FTB65486 4716790 C to T
FTB65487 4717326 G to A
FTB65488 4717937 G to A
FTB65489 4726616 G to A
FTB65490 4728246 T to G
FTB65491 4728364 C to T
FTB65492 4728469 G to C
FTB65493 4729408 A to G
FTB65494 4734399 C to T
FTB65495 4740740 C to T
FTB65496 4745233 A to T
FTB65497 4745791 A to C
FTB65498 4758950 T to C
FTB65499 4762293 A to G
FTB65500 4772006 C to T
FTB65501 4773838 T to G
FTB65502 4779136 G to A
FTB65503 4780302 G to C
FTB65504 4782770 G to A
FTB65505 4793052 C to T
FTB65506 4800177 A to G
FTB65507 4802140 C to T
FTB65508 4803952 T to C
FTB65509 4828805 C to T
FTB65510 4833078 G to C
FTB65511 4837473 T to A
FTB65512 4837980 A to T
FTB65513 4847928 G to T
FTB65514 4849852 T to C
FTB65515 4881931 T to C
FTB65516 4884972 G to A
FTB65517 4903288 A to C
FTB65518 4910951 C to T
FTB65519 4920120 G to T
FTB65520 4926912 G to T
FTB65521 4929415 T to A
FTB65522 4933300 C to T
FTB65523 4967201 C to G
FTB65524 4969054 C to T
FTB65525 4972556 G to A
FTB65526 4984964 A to T
FTB65527 4988284 T to A
FTB65528 4996337 T to A
FTB65529 5000330 G to C
FTB65530 5001722 C to G
FTB65531 5002829 T to C
FTB65532 5011188 G to T
FTB65533 5011899 A to T
FTB65534 5012995 G to A
FTB65535 5013039 G to C
FTB65536 5016235 G to A
FTB65537 5021150 G to T
FTB65538 5021522 T to C
FTB65539 5021524 T to A
FTB65540 5022605 A to G
FTB65541 5035682 T to C
FTB65542 5050648 C to T
FTB65543 5050693 T to C
FTB65544 5050696 T to C
FTB65545 5050700 G to T
FTB65546 5052023 C to T
FTB65547 5056647 T to C
FTB65548 5067362 A to C
FTB65549 5079831 A to G
FTB65550 5086633 C to G
FTB65551 5091657 A to T
FTB65552 5095045 A to C
FTB65553 5112102 C to T
FTB65554 5113036 G to A
FTB65555 5115709 G to T
FTB65556 5123431 T to G
FTB65557 5130105 T to C
FTB65558 5130975 A to G
FTB65559 5136740 A to G
FTB65560 5163298 A to G
FTB65561 5163714 C to A
FTB65562 5170844 A to G
FTB65563 5177439 G to C
FTB65564 5181174 G to A
FTB65565 5183111 C to T
FTB65566 5184417 C to T
FTB65567 5193340 T to C
FTB65568 5200453 G to A
FTB65569 5200805 T to C
FTB65570 5202754 C to T
FTB65571 5206316 A to T
FTB65572 5209487 C to A
FTB65573 5212129 A to G
FTB65574 5213269 G to A
FTB65575 5218170 C to T
FTB65576 5223424 C to G
FTB65577 5225327 A to C
FTB65578 5235194 G to A
FTB65579 5242920 T to C
FTB65580 5243632 G to A
FTB65581 5248465 A to G
FTB65582 5255569 G to C
FTB65583 5256030 G to A
FTB65584 5263425 C to G
FTB65585 5264945 C to A
FTB65586 5268760 A to T
FTB65587 5269297 T to A
FTB65588 5272243 T to G
FTB65589 5279234 C to T
FTB65590 5288175 A to G
FTB65591 5297592 G to T
FTB65592 5298543 T to A
FTB65593 5298619 G to C
FTB65594 5299653 T to C
FTB65595 5311248 T to C
FTB65596 5311779 T to G
FTB65597 5312191 T to G
FTB65598 5315506 G to A
FTB65599 5318505 A to G
FTB65600 5334027 C to G
FTB65601 5335548 G to T
FTB65602 5337075 T to A
FTB65603 5341265 C to G
FTB65604 5350880 T to A
FTB65605 5356552 G to A
FTB65606 5361580 C to T
FTB65607 5370434 A to G
FTB65608 5376781 C to T
FTB65609 5378686 G to T
FTB65610 5381282 A to G
FTB65611 5383924 G to T
FTB65612 5384751 A to C
FTB65613 5384897 T to A
FTB65614 5384908 A to C
FTB65615 5385888 T to C
FTB65616 5388817 C to T
FTB65617 5389097 A to G
FTB65618 5392503 T to C
FTB65619 5400326 A to G
FTB65620 5410334 C to A
FTB65621 5411469 C to T
FTB65622 5413794 G to C
FTB65623 5414699 T to A
FTB65624 5437359 G to T
FTB65625 5440237 C to T
FTB65626 5443905 A to C
FTB65627 5445432 T to C
FTB65628 5446572 T to C
FTB65629 5446727 T to C
FTB65630 5448187 C to G
FTB65631 5450743 T to A
FTB65632 5451340 C to T
FTB65633 5461968 C to T
FTB65634 5462502 C to G
FTB65635 5463835 A to T
FTB65636 5464002 A to G
FTB65637 5485750 G to A
FTB65638 5490413 C to A
FTB65639 5492498 T to C
FTB65640 5501513 G to A
FTB65641 5506202 A to T
FTB65642 5511623 T to A
FTB65643 5518427 A to G
FTB65644 5522654 G to A
FTB65645 5527749 C to A
FTB65646 5531873 T to C
FTB65647 5533424 T to C
FTB65648 5552457 T to C
FTB65649 5552549 G to C
FTB65650 5562486 G to T
FTB65651 5585657 G to A
FTB65652 5587552 G to A
FTB65653 5593212 T to C
FTB65654 5597814 G to T
FTB65655 5601669 T to A
FTB65656 5604676 G to A
FTB65657 5605942 T to G
FTB65658 5615795 C to A
FTB65659 5618462 G to A
FTB65660 5621898 A to G
FTB65661 5624598 A to G
FTB65662 5626061 T to C
FTB65663 5630420 C to T
FTB65664 5630783 G to C
FTB65665 5632337 A to G
FTB65666 5632863 C to A
FTB65667 5644907 A to G
FTB65668 5646423 T to C
FTB65669 5647335 T to G
FTB65670 5651955 T to G
FTB65671 5654205 G to A
FTB65672 5658953 C to T
FTB65673 5665541 T to A
FTB65674 5666584 G to C
FTB65675 5666722 C to T
FTB65676 5667183 A to T
FTB65677 5668833 C to G
FTB65678 5674295 G to A
FTB65679 5681759 A to C
FTB65680 5682583 A to G
FTB65681 5689576 T to C
FTB65682 5692256 C to T
FTB65683 5692262 A to G
FTB65684 5693782 T to C
FTB65685 5698805 T to A
FTB65686 5702711 C to T
FTB65687 5704788 C to A
FTB65688 5705115 G to A
FTB65689 5709390 C to T
FTB65690 5720706 C to A
FTB65691 5722997 C to T
FTB65692 5723104 T to A
FTB65693 5724203 G to T
FTB65694 5725323 A to G
FTB65695 5727140 C to G
FTB65696 5730835 A to C
FTB65697 5738813 T to C
FTB65698 5739324 C to T
FTB65699 5743529 A to T
FTB65700 5744206 C to T
FTB65701 5754507 A to G
FTB65702 5754829 T to C
FTB65703 5757362 A to C
FTB65704 5760433 A to G
FTB65705 5760910 C to T
FTB65706 5766235 A to C
FTB65707 5771634 T to G
FTB65708 5778123 C to T
FTB65709 5778970 G to T
FTB65710 5792144 G to C
FTB65711 5792211 A to G
FTB65712 5798092 A to G
FTB65713 5799069 G to T
FTB65714 5824934 A to T
FTB65715 5826251 A to G
FTB65716 5826485 G to C
FTB65717 5841478 T to C
FTB65718 5842036 G to C
FTB65719 5853647 A to G
FTB65720 5856576 A to G
FTB65721 5856795 T to A
FTB65722 5865401 C to T
FTB65723 5866384 G to A
FTB65724 5873681 A to T
FTB65725 5873719 T to C
FTB65726 5875397 C to G
FTB65727 5880762 A to G
FTB65728 5887227 A to C
FTB65729 5888509 T to A
FTB65730 5893438 A to C
FTB65731 5904458 G to T
FTB65732 5917214 A to T
FTB65733 5917696 G to A
FTB65734 5931559 T to C
FTB65735 5948088 A to C
FTB65736 5951437 A to C
FTB65737 5952759 T to C
FTB65738 5953976 C to G
FTB65739 5955603 C to T
FTB65740 5966076 T to C
FTB65741 5967739 A to G
FTB65742 5971281 A to G
FTB65743 5975082 C to G
FTB65744 5985737 A to G
FTB65745 6005348 C to T
FTB65746 6011326 C to G
FTB65747 6013015 C to G
FTB65748 6019594 C to T
FTB65749 6027032 A to G
FTB65750 6029127 T to C
FTB65751 6032378 G to T
FTB65752 6032380 A to T
FTB65753 6042282 A to G
FTB65754 6046528 C to T
FTB65755 6048537 A to G
FTB65756 6051282 G to A
FTB65757 6062340 T to C
FTB65758 6071198 T to C
FTB65759 6073646 T to C
FTB65760 6084283 T to A
FTB65761 6089598 A to C
FTB65762 6092412 T to G
FTB65763 6097732 G to A
FTB65764 6099012 A to C
FTB65765 6100664 A to G
FTB65766 6101518 C to A
FTB65767 6108577 G to A
FTB65768 6119603 C to T
FTB65769 6130369 A to C
FTB65770 6133474 G to A
FTB65771 6135702 C to A
FTB65772 6162749 G to A
FTB65773 6162861 T to C
FTB65774 6163023 G to C
FTB65775 6163537 A to G
FTB65776 6173627 T to C
FTB65777 6188329 A to G
FTB65778 6197857 T to C
FTB65779 6198972 A to G
FTB65780 6202958 A to C
FTB65781 6206440 G to A
FTB65782 6206540 G to C
FTB65783 6209427 A to G
FTB65784 6214234 A to T
FTB65785 6215411 G to A
FTB65786 6220524 A to G
FTB65787 6220673 A to G
FTB65788 6226512 G to T
FTB65789 6235460 A to G
FTB65790 6312038 T to C
FTB65791 6333710 T to C
FTB65792 6404282 C to T
FTB65793 6421332 A to G
FTB65794 6479426 G to A
FTB65795 6483923 G to A
FTB65796 6488830 G to A
FTB65797 6495719 G to A
FTB65798 6501714 G to A
FTB65799 6503489 T to C
FTB65800 6508203 C to A
FTB65801 6510551 A to G
FTB65802 6512842 C to T
FTB65803 6516176 T to G
FTB65804 6522137 G to A
FTB65805 6522466 A to G
FTB65806 6530138 G to T
FTB65807 6543998 T to A
FTB65808 6550710 T to A
FTB65809 6551914 A to G
FTB65810 6558141 A to G
FTB65811 6567659 T to C
FTB65812 6567882 C to G
FTB65813 6572532 T to A
FTB65814 6575145 G to T
FTB65815 6585365 C to G
FTB65816 6586463 T to A
FTB65817 6588559 C to T
FTB65818 6590858 A to T
FTB65819 6592465 G to A
FTB65820 6606140 A to T
FTB65821 6613052 A to G
FTB65822 6626547 C to T
FTB65823 6632893 A to G
FTB65824 6638906 C to A
FTB65825 6641455 C to T
FTB65826 6643931 T to A
FTB65827 6651166 A to G
FTB65828 6652989 G to C
FTB65829 6674491 C to T
FTB65830 6675069 C to T
FTB65831 6712452 T to C
FTB65832 6713741 T to C
FTB65833 6714457 C to A
FTB65834 6716640 T to C
FTB65835 6717314 C to T
FTB65836 6718896 T to A
FTB65837 6722000 A to G
FTB65838 6724380 A to G
FTB65839 6732501 T to G
FTB65840 6741452 A to G
FTB65841 6748077 A to G
FTB65842 9055247 C to T
FTB65843 9334933 G to C
FTB65844 9537472 A to G
FTB65845 9538590 C to G
FTB65846 9546892 G to C
FTB65847 9549338 A to T
FTB65848 9553286 A to G
FTB65849 9631717 T to C
FTB65850 9645165 C to T
FTB65851 9654148 T to A
FTB65852 9658587 C to A
FTB65853 9659240 A to G
FTB65854 9661324 A to T
FTB65855 9666297 C to T
FTB65856 9672528 C to T
FTB65857 9682473 T to A
FTB65858 9687473 A to T
FTB65859 9687536 T to C
FTB65860 9780574 G to C
FTB65861 9780705 T to C
FTB65862 9812084 C to G
FTB65863 9828934 A to C
FTB65864 9836530 T to C
FTB65865 9854331 G to A
FTB65866 9900866 G to T
FTB65867 9908924 T to G
FTB65868 9908925 C to G
FTB65869 9908937 T to C
FTB65870 9908939 T to C
FTB65871 9921471 T to G
FTB65872 9931470 T to G
FTB65873 9936986 T to C
FTB65874 9954864 A to G
FTB65875 9956191 C to T
FTB65876 9956798 T to C
FTB65877 11694654 C to G
FTB65878 11695998 G to T
FTB65879 11698638 A to C
FTB65880 11700026 T to A
FTB65881 11702017 G to T
FTB65882 11706856 T to C
FTB65883 11709983 G to A
FTB65884 11713307 A to T
FTB65885 11724308 G to T
FTB65886 11725884 G to A
FTB65887 11732265 A to T
FTB65888 11737692 T to C
FTB65889 11740578 G to T
FTB65890 15879125 T to C
FTB65891 16173019 C to A
FTB65892 16422180 G to A
FTB65893 17351545 C to A
FTB65894 21478480 A to G
FTB65895 21479102 G to A
FTB65896 21484607 C to A
FTB65897 21486498 C to T
FTB65898 21488117 A to T
FTB65899 21488414 G to T
FTB65900 21571405 C to A
FTB65901 21577463 A to G
FTB65902 21580143 A to C
FTB65903 21755352 G to A
FTB65904 21849014 G to T
FTB65905 21854243 T to A
FTB65906 21860847 A to T
FTB65907 21861791 C to T
FTB65908 22224314 C to A
FTB65909 22337668 A to C
FTB65910 22359402 T to A
FTB65911 22369164 A to G
FTB65912 11644027 T to G
FTB65913 11256271 C to G
FTB65914 10657781 C to G
FTB65915 10764292 C to T
FTB65916 10874188 T to A
FTB65917 10839993 A to C
FTB65918 10777455 A to T
FTB65919 2791892 T to C
FTB65920 2792876 A to T
FTB65921 2797009 C to T
FTB65922 2804725 T to C
FTB65923 2822977 A to G
FTB65924 2838512 C to T
FTB65925 2842766 A to G
FTB65926 2843646 A to G
FTB65927 2850620 G to A
FTB65928 2859036 A to G
FTB65929 2871608 A to G
FTB65930 2873413 T to G
FTB65931 2874755 A to C
FTB65932 2881072 G to C
FTB65933 2881958 T to G
FTB65934 2883557 C to T
FTB65935 2891343 A to C
FTB65936 2892149 G to C
FTB65937 2894705 C to T
FTB65938 2905684 G to A
FTB65939 2907266 G to A
FTB65940 2916753 C to T
FTB65941 2926090 C to G
FTB65942 2934881 A to C
FTB65943 2939278 T to A
FTB65944 2947894 G to C
FTB65945 2948341 A to G
FTB65946 2949662 T to C
FTB65947 2949822 C to G
FTB65948 2955954 C to G
FTB65949 2957937 G to A
FTB65950 2962525 A to G
FTB65951 2970327 T to C
FTB65952 2974502 A to G
FTB65953 2988146 C to G
FTB65954 6757635 T to C
FTB65955 6759283 A to C
FTB65956 6766274 C to T
FTB65957 6775492 C to A
FTB65958 6781745 C to G
FTB65959 6790340 T to C
FTB65960 6791797 T to A
FTB65961 6793711 C to T
FTB65962 6793949 T to C
FTB65963 6798140 A to G
FTB65964 6801600 A to G
FTB65965 6805357 A to G
FTB65966 6806070 C to T
FTB65967 6819820 C to G
FTB65968 6825058 T to C
FTB65969 6836340 A to C
FTB65970 6839170 A to G
FTB65971 6843670 T to G
FTB65972 6849311 A to G
FTB65973 6849926 C to T
FTB65974 6861253 A to G
FTB65975 6861911 T to C
FTB65976 6867933 A to G
FTB65977 6871694 T to C
FTB65978 6874616 G to A
FTB65979 6880835 C to G
FTB65980 6884014 A to G
FTB65981 6884073 A to G
FTB65982 6887417 G to T
FTB65983 6892211 C to G
FTB65984 6893650 C to A
FTB65985 6900620 C to T
FTB65986 6902570 A to T
FTB65987 6923364 G to C
FTB65988 6946373 T to G
FTB65989 6955590 C to A
FTB65990 6956135 C to G
FTB65991 6956974 C to T
FTB65992 6958533 A to G
FTB65993 6959578 A to T
FTB65994 6961095 A to G
FTB65995 6962723 G to A
FTB65996 6968807 T to C
FTB65997 6971877 G to T
FTB65998 6972273 T to C
FTB65999 7001200 G to A
FTB66000 7005597 G to C
FTB66001 7017189 G to T
FTB66002 7027786 C to A
FTB66003 7030376 G to A
FTB66004 7035882 A to G
FTB66005 7040101 C to A
FTB66006 7050856 C to A
FTB66007 7052655 A to G
FTB66008 7054682 C to T
FTB66009 7063720 G to A
FTB66010 7071007 G to T
FTB66011 7083007 A to G
FTB66012 7083165 G to A
FTB66013 7087529 G to A
FTB66014 7091693 T to G
FTB66015 7100158 A to T
FTB66016 7103368 A to T
FTB66017 7103815 C to T
FTB66018 7103895 T to C
FTB66019 7105178 G to A
FTB66020 7151462 G to T
FTB66021 7160907 G to A
FTB66022 7162928 G to A
FTB66023 7165826 G to A
FTB66024 7165840 C to T
FTB66025 7165841 A to G
FTB66026 7165846 G to C
FTB66027 7165847 A to T
FTB66028 7171153 C to T
FTB66029 7174261 T to G
FTB66030 7177557 A to C
FTB66031 7190159 C to T
FTB66032 7201341 C to A
FTB66033 7212463 T to A
FTB66034 7228627 G to C
FTB66035 7235981 C to A
FTB66036 7260074 A to G
FTB66037 7277159 A to G
FTB66038 7281924 A to C
FTB66039 7306459 T to G
FTB66040 7309867 G to A
FTB66041 7311671 G to A
FTB66042 7311719 G to C
FTB66043 7311740 G to A
FTB66044 7322389 A to G
FTB66045 7323947 G to T
FTB66046 7328532 G to A
FTB66047 7334034 T to C
FTB66048 7345281 G to A
FTB66049 7347423 C to T
FTB66050 7365719 T to C
FTB66051 7379931 C to T
FTB66052 7385209 A to G
FTB66053 7404621 A to G
FTB66054 7410745 T to C
FTB66055 7417682 T to C
FTB66056 7421556 G to A
FTB66057 7428216 A to T
FTB66058 7455977 A to G
FTB66059 7466432 C to A
FTB66060 7468884 C to T
FTB66061 7480501 A to T
FTB66062 7494029 T to A
FTB66063 7517259 G to A
FTB66064 7522443 G to A
FTB66065 7535236 T to C
FTB66066 7541071 G to A
FTB66067 7558344 A to G
FTB66068 7569787 C to T
FTB66069 7578145 A to C
FTB66070 7587775 A to G
FTB66071 7589710 A to G
FTB66072 7651944 A to G
FTB66073 7656446 G to A
FTB66074 7656876 A to G
FTB66075 7682058 G to C
FTB66076 7684434 C to A
FTB66077 7686843 A to G
FTB66078 7690785 T to G
FTB66079 7693534 T to C
FTB66080 7701823 A to C
FTB66081 7716200 C to G
FTB66082 7719549 G to T
FTB66083 7723710 G to T
FTB66084 7730001 C to T
FTB66085 7774096 G to C
FTB66086 7777120 G to A
FTB66087 7778376 A to T
FTB66088 7781799 T to G
FTB66089 7786974 T to A
FTB66090 7789596 A to T
FTB66091 7791503 A to G
FTB66092 7797850 G to T
FTB66093 7799305 G to C
FTB66094 7802233 A to G
FTB66095 7802295 G to T
FTB66096 7806938 G to A
FTB66097 7816246 T to C
FTB66098 7829416 C to G
FTB66099 7829794 C to G
FTB66100 7837687 G to C
FTB66101 7840214 A to G
FTB66102 7862011 G to T
FTB66103 7864059 A to T
FTB66104 7866897 G to T
FTB66105 7881147 A to C
FTB66106 7881713 C to A
FTB66107 7889408 C to G
FTB66108 7893411 C to G
FTB66109 7904630 G to A
FTB66110 7914728 A to G
FTB66111 7921372 G to T
FTB66112 7933346 T to A
FTB66113 7936145 C to G
FTB66114 7950406 A to G
FTB66115 7963202 C to G
FTB66116 7967485 T to C
FTB66117 7971845 C to A
FTB66118 7977245 T to C
FTB66119 7982189 T to G
FTB66120 7982396 G to C
FTB66121 7987080 T to C
FTB66122 7987116 T to C
FTB66123 7987830 G to T
FTB66124 7989438 C to T
FTB66125 7992977 T to C
FTB66126 7997837 G to C
FTB66127 7998602 G to A
FTB66128 8000012 C to G
FTB66129 8000040 G to T
FTB66130 8000608 G to A
FTB66131 8008564 T to A
FTB66132 8008846 A to G
FTB66133 8011742 G to A
FTB66134 8022024 G to A
FTB66135 8031531 A to T
FTB66136 8034234 T to C
FTB66137 8036330 G to T
FTB66138 8048724 G to C
FTB66139 8053533 A to G
FTB66140 8057779 C to T
FTB66141 8061363 A to G
FTB66142 8067702 G to T
FTB66143 8070193 T to C
FTB66144 8077920 G to A
FTB66145 8106922 T to G
FTB66146 8118673 A to C
FTB66147 8122396 T to G
FTB66148 8122677 G to A
FTB66149 8148344 T to G
FTB66150 8148488 C to G
FTB66151 8149881 A to G
FTB66152 8160442 G to A
FTB66153 8168698 G to C
FTB66154 8179342 T to C
FTB66155 8182836 C to T
FTB66156 8194030 C to A
FTB66157 8201704 A to G
FTB66158 8203992 G to A
FTB66159 8204757 A to C
FTB66160 8205621 G to C
FTB66161 8212620 G to C
FTB66162 8215043 G to A
FTB66163 8217794 T to A
FTB66164 8224713 G to A
FTB66165 8224932 G to C
FTB66166 8245145 G to A
FTB66167 8256203 C to A
FTB66168 8258119 T to A
FTB66169 8261220 C to T
FTB66170 8261936 C to A
FTB66171 8263340 G to T
FTB66172 8273626 G to A
FTB66173 8288197 T to C
FTB66174 8317177 A to C
FTB66175 8322093 G to T
FTB66176 8323920 A to G
FTB66177 8345246 C to G
FTB66178 8349849 T to A
FTB66179 8362171 A to G
FTB66180 8372238 G to T
FTB66181 8412895 T to G
FTB66182 8424407 G to T
FTB66183 8429770 G to C
FTB66184 8430843 T to C
FTB66185 8432878 G to C
FTB66186 8439451 G to C
FTB66187 8445912 A to C
FTB66188 8448345 G to A
FTB66189 8457055 C to T
FTB66190 8464757 T to C
FTB66191 8470979 C to T
FTB66192 8471824 T to C
FTB66193 8474383 A to G
FTB66194 8478113 C to T
FTB66195 8487147 A to G
FTB66196 8487601 A to C
FTB66197 8488719 T to C
FTB66198 8495438 T to C
FTB66199 8497840 G to A
FTB66200 8504446 A to T
FTB66201 8512791 C to T
FTB66202 8513433 G to A
FTB66203 8514585 C to T
FTB66204 8514608 C to A
FTB66205 8515186 T to C
FTB66206 8522675 C to T
FTB66207 8525150 T to C
FTB66208 8527899 T to C
FTB66209 8535631 C to T
FTB66210 8535998 G to A
FTB66211 8542049 C to T
FTB66212 8547002 A to C
FTB66213 8549281 G to T
FTB66214 8554812 A to G
FTB66215 8562229 A to G
FTB66216 8566457 T to C
FTB66217 8572263 A to G
FTB66218 8576259 A to G
FTB66219 8588764 C to T
FTB66220 8591910 C to A
FTB66221 8612812 C to T
FTB66222 8615635 C to T
FTB66223 8618017 G to A
FTB66224 8619397 G to A
FTB66225 8645750 A to G
FTB66226 8664148 A to G
FTB66227 8666288 G to C
FTB66228 8673079 C to T
FTB66229 8682420 A to G
FTB66230 8689603 T to G
FTB66231 8698879 A to G
FTB66232 8714683 T to C
FTB66233 8716305 A to C
FTB66234 8717388 C to T
FTB66235 8717656 A to G
FTB66236 8724197 G to T
FTB66237 8726470 G to A
FTB66238 8744230 G to C
FTB66239 8749057 A to G
FTB66240 8756512 C to T
FTB66241 8762985 C to T
FTB66242 8765815 T to G
FTB66243 8768670 G to C
FTB66244 8786127 G to C
FTB66245 8797508 A to G
FTB66246 8797791 T to A
FTB66247 8800722 T to C
FTB66248 8804354 C to T
FTB66249 8805616 C to G
FTB66250 8823622 G to T
FTB66251 8824897 C to G
FTB66252 8829419 A to C
FTB66253 8833985 G to A
FTB66254 8842271 C to A
FTB66255 8842398 G to A
FTB66256 8848552 T to C
FTB66257 8850072 T to A
FTB66258 8887203 A to G
FTB66259 8894201 G to A
FTB66260 8897616 A to T
FTB66261 8903410 G to A
FTB66262 8903557 G to A
FTB66263 8904358 G to T
FTB66264 8907461 G to A
FTB66265 8917147 C to A
FTB66266 8929694 T to C
FTB66267 8942508 C to G
FTB66268 8955772 G to T
FTB66269 8979135 G to A
FTB66270 8983289 C to A
FTB66271 8984957 T to C
FTB66272 8987443 T to C
FTB66273 8991247 A to C
FTB66274 8993158 A to G
FTB66275 8998450 C to G
FTB66276 8998641 A to C
FTB66277 9002259 A to G
FTB66278 9005709 A to G
FTB66279 9011839 C to T
FTB66280 9020054 G to A
FTB66281 9023399 G to A
FTB66282 9026584 T to C
FTB66283 9036193 C to T
FTB66284 9038606 C to G
FTB66285 9040393 T to C
FTB66286 9111669 C to A
FTB66287 9119751 C to A
FTB66288 9120851 C to T
FTB66289 9120957 T to C
FTB66290 9122791 C to T
FTB66291 9127596 A to G
FTB66292 9129880 C to T
FTB66293 9136954 C to A
FTB66294 9148923 G to C
FTB66295 9158081 C to T
FTB66296 9176694 C to A
FTB66297 9208400 G to A
FTB66298 9211399 C to T
FTB66299 9224590 C to A
FTB66300 9224666 C to G
FTB66301 9233903 T to A
FTB66302 9246620 C to A
FTB66303 9250435 T to C
FTB66304 9252554 A to G
FTB66305 9253392 G to T
FTB66306 9261149 A to C
FTB66307 9276197 T to C
FTB66308 9278504 C to T
FTB66309 9282037 T to G
FTB66310 9284635 C to A
FTB66311 9286685 C to A
FTB66312 9301513 A to G
FTB66313 9309195 A to G
FTB66314 9312624 C to A
FTB66315 9319218 G to A
FTB66316 9326120 C to A
FTB66317 9327225 G to A
FTB66318 9557864 A to G
FTB66319 9558578 T to G
FTB66320 9599303 A to C
FTB66321 9599327 A to G
FTB66322 9603319 A to G
FTB66323 9610264 T to C
FTB66324 9617359 T to C
FTB66325 9619433 G to A
FTB66326 9621452 G to C
FTB66327 9972290 C to G
FTB66328 9984378 G to T
FTB66329 10014670 G to A
FTB66330 10021304 A to G
FTB66331 10031614 T to C
FTB66332 10031659 C to G
FTB66333 10037234 G to A
FTB66334 10052466 G to A
FTB66335 10056413 C to G
FTB66336 11752156 T to A
FTB66337 11753471 A to T
FTB66338 11758202 C to G
FTB66339 11761455 G to A
FTB66340 11764117 A to G
FTB66341 11765230 C to T
FTB66342 11769757 G to A
FTB66343 11772428 T to A
FTB66344 11772803 T to C
FTB66345 11773941 C to T
FTB66346 11778612 G to A
FTB66347 11782462 A to G
FTB66348 11786755 A to C
FTB66349 11794626 C to T
FTB66350 11795001 T to C
FTB66351 11798267 G to T
FTB66352 11800434 C to G
FTB66353 11809371 C to T
FTB66354 11810341 A to G
FTB66355 11819811 G to A
FTB66356 11821372 G to T
FTB66357 11822151 C to T
FTB66358 11822169 C to A
FTB66359 11822444 C to G
FTB66360 11827085 T to C
FTB66361 11829312 C to T
FTB66362 11839080 C to A
FTB66363 11840158 C to A
FTB66364 11849903 A to T
FTB66365 11861657 T to C
FTB66366 11862614 G to A
FTB66367 11868455 G to C
FTB66368 11868891 G to T
FTB66369 11869942 C to A
FTB66370 11873514 A to G
FTB66371 11879619 G to A
FTB66372 11885042 C to T
FTB66373 11890343 G to A
FTB66374 11890887 T to A
FTB66375 11893551 A to T
FTB66376 11893568 G to A
FTB66377 11905217 G to A
FTB66378 11908218 C to T
FTB66379 11913554 A to G
FTB66380 11927221 G to A
FTB66381 11929455 T to C
FTB66382 11932983 T to G
FTB66383 11940382 A to G
FTB66384 11940741 G to C
FTB66385 11947011 A to C
FTB66386 11948440 C to A
FTB66387 11955011 C to A
FTB66388 11958559 G to C
FTB66389 11959331 T to G
FTB66390 11961016 A to G
FTB66391 11962515 A to G
FTB66392 11972753 A to G
FTB66393 11974585 G to T
FTB66394 11977538 G to A
FTB66395 11977982 A to T
FTB66396 11983995 G to A
FTB66397 11984461 T to G
FTB66398 11987705 A to G
FTB66399 11995304 A to G
FTB66400 12013706 C to T
FTB66401 12015882 G to A
FTB66402 12016034 C to T
FTB66403 12017732 C to T
FTB66404 12020445 G to A
FTB66405 12021254 A to T
FTB66406 12030068 G to C
FTB66407 12038989 A to G
FTB66408 12048076 C to A
FTB66409 12056422 C to A
FTB66410 12056843 G to A
FTB66411 12063376 C to G
FTB66412 12065098 T to A
FTB66413 12065581 C to T
FTB66414 12067582 C to T
FTB66415 12067930 A to T
FTB66416 12081632 G to T
FTB66417 12085027 G to A
FTB66418 12085078 C to A
FTB66419 12099146 A to G
FTB66420 12113500 C to T
FTB66421 12124346 A to T
FTB66422 12124998 A to C
FTB66423 12141538 G to T
FTB66424 12150984 T to C
FTB66425 12152670 G to A
FTB66426 12159674 G to C
FTB66427 12165049 C to A
FTB66428 12165781 T to A
FTB66429 12167948 T to C
FTB66430 12173993 T to C
FTB66431 12189873 A to G
FTB66432 12196193 A to G
FTB66433 12197604 C to T
FTB66434 12199110 C to G
FTB66435 12200770 G to A
FTB66436 12209964 G to T
FTB66437 12211515 A to G
FTB66438 12215918 C to A
FTB66439 12217412 G to A
FTB66440 12218297 T to C
FTB66441 12218503 C to T
FTB66442 12218983 G to C
FTB66443 12226208 G to T
FTB66444 12229027 A to T
FTB66445 12231328 C to T
FTB66446 12245013 G to C
FTB66447 12246622 G to A
FTB66448 12252169 C to A
FTB66449 12267777 G to C
FTB66450 12270897 A to G
FTB66451 12275018 G to A
FTB66452 12275551 T to C
FTB66453 12280139 G to C
FTB66454 12282012 A to C
FTB66455 12284061 C to G
FTB66456 12300474 A to C
FTB66457 12306332 G to T
FTB66458 12316107 G to A
FTB66459 12323894 T to C
FTB66460 12332574 C to T
FTB66461 12343105 T to C
FTB66462 12349076 C to T
FTB66463 12351697 A to G
FTB66464 12353359 G to A
FTB66465 12354966 T to C
FTB66466 12368650 A to G
FTB66467 12371531 T to C
FTB66468 12413536 A to G
FTB66469 12414669 C to G
FTB66470 12418206 C to G
FTB66471 12420740 C to T
FTB66472 12434975 A to G
FTB66473 12443771 A to C
FTB66474 12449974 A to T
FTB66475 12457303 A to G
FTB66476 12468980 C to A
FTB66477 12469799 A to G
FTB66478 12471510 G to C
FTB66479 12471798 A to C
FTB66480 12478540 G to T
FTB66481 12479569 G to A
FTB66482 12480274 C to T
FTB66483 12483440 C to A
FTB66484 12486315 A to G
FTB66485 12490113 G to A
FTB66486 12516268 A to C
FTB66487 12533951 T to C
FTB66488 12548176 G to A
FTB66489 12558897 G to T
FTB66490 12566077 C to T
FTB66491 12577726 C to A
FTB66492 12584500 A to G
FTB66493 12593947 T to A
FTB66494 12595953 C to A
FTB66495 12606730 G to T
FTB66496 12608751 A to G
FTB66497 12619587 T to C
FTB66498 12622492 T to A
FTB66499 12623312 T to C
FTB66500 12647112 C to T
FTB66501 12660038 T to C
FTB66502 12680864 T to C
FTB66503 12683107 T to C
FTB66504 12690426 A to G
FTB66505 12714044 C to T
FTB66506 12715029 G to A
FTB66507 12716689 C to T
FTB66508 12731828 A to G
FTB66509 12748748 C to A
FTB66510 12752393 A to G
FTB66511 12757405 G to C
FTB66512 12775835 G to A
FTB66513 12779670 A to G
FTB66514 12788260 T to C
FTB66515 12819672 A to G
FTB66516 12821983 A to C
FTB66517 12828997 T to C
FTB66518 12830559 C to T
FTB66519 12835300 C to T
FTB66520 12840219 A to G
FTB66521 12840917 G to A
FTB66522 12842841 C to T
FTB66523 12844793 C to T
FTB66524 12855063 A to G
FTB66525 12855866 T to C
FTB66526 12859319 C to A
FTB66527 12863760 A to T
FTB66528 12863761 A to T
FTB66529 12863924 G to A
FTB66530 12868340 G to C
FTB66531 12875724 G to A
FTB66532 12878060 A to C
FTB66533 12888363 T to A
FTB66534 12888805 T to G
FTB66535 12893668 G to T
FTB66536 12913433 C to T
FTB66537 12915030 A to G
FTB66538 12929811 T to A
FTB66539 12946465 T to G
FTB66540 12948447 G to A
FTB66541 12961749 G to A
FTB66542 12968133 C to T
FTB66543 12970466 T to C
FTB66544 12972259 G to T
FTB66545 12980133 A to G
FTB66546 12980546 A to T
FTB66547 12980972 A to C
FTB66548 12983184 C to T
FTB66549 12983658 A to G
FTB66550 13017244 G to A
FTB66551 13019933 A to G
FTB66552 13023435 T to C
FTB66553 13024472 C to A
FTB66554 13041385 C to T
FTB66555 13041586 C to A
FTB66556 13046301 G to T
FTB66557 13046783 C to G
FTB66558 13058873 A to G
FTB66559 13078871 C to G
FTB66560 13088276 C to G
FTB66561 13089542 T to C
FTB66562 13091707 C to A
FTB66563 13092808 A to C
FTB66564 13092818 G to C
FTB66565 13100390 G to A
FTB66566 13103647 A to G
FTB66567 13108446 C to G
FTB66568 13136381 A to T
FTB66569 13144458 G to A
FTB66570 13163762 G to A
FTB66571 13175120 T to C
FTB66572 13193812 G to T
FTB66573 13193883 A to C
FTB66574 13194457 C to T
FTB66575 13203835 C to T
FTB66576 13223752 C to A
FTB66577 13241862 T to C
FTB66578 13242459 A to G
FTB66579 13247802 A to G
FTB66580 13279136 A to G
FTB66581 13283108 T to C
FTB66582 13288026 A to G
FTB66583 13291504 A to C
FTB66584 13297689 G to C
FTB66585 13309148 T to A
FTB66586 13312016 A to C
FTB66587 13314287 A to G
FTB66588 13317889 G to A
FTB66589 13319149 A to T
FTB66590 13324693 C to T
FTB66591 13332827 G to A
FTB66592 13337441 A to G
FTB66593 13359188 T to C
FTB66594 13359450 C to T
FTB66595 13361302 C to T
FTB66596 13362791 A to G
FTB66597 13368537 G to A
FTB66598 13386346 C to G
FTB66599 13389806 G to C
FTB66600 13398830 T to A
FTB66601 13400865 G to A
FTB66602 13402578 A to T
FTB66603 13416459 C to T
FTB66604 13416643 T to A
FTB66605 13424279 G to A
FTB66606 13435601 G to A
FTB66607 13444819 A to T
FTB66608 13444820 C to G
FTB66609 13446188 G to C
FTB66610 13447753 G to C
FTB66611 13450683 G to A
FTB66612 13456284 A to G
FTB66613 13462920 G to A
FTB66614 13468109 T to C
FTB66615 13478791 T to C
FTB66616 13481020 C to G
FTB66617 13490735 G to T
FTB66618 13498074 C to T
FTB66619 13498744 A to G
FTB66620 13504808 C to T
FTB66621 13508692 G to A
FTB66622 13522257 C to G
FTB66623 13549562 A to C
FTB66624 13550080 G to A
FTB66625 13567293 A to G
FTB66626 13578297 C to G
FTB66627 13579165 G to T
FTB66628 13584884 C to T
FTB66629 13585514 C to T
FTB66630 13586243 A to G
FTB66631 13591560 C to T
FTB66632 13597427 C to T
FTB66633 13597694 T to C
FTB66634 13597816 G to A
FTB66635 13602270 G to C
FTB66636 13605010 C to G
FTB66637 13605163 C to A
FTB66638 13609453 G to T
FTB66639 13610913 A to C
FTB66640 13612503 T to C
FTB66641 13614405 T to C
FTB66642 13614626 A to C
FTB66643 13614652 T to G
FTB66644 13617412 G to A
FTB66645 13619661 C to A
FTB66646 13626254 C to A
FTB66647 13638791 A to G
FTB66648 13638989 G to A
FTB66649 13642923 T to C
FTB66650 13654133 A to G
FTB66651 13673889 G to T
FTB66652 13675711 A to G
FTB66653 13678454 T to C
FTB66654 13678680 A to G
FTB66655 13679745 T to C
FTB66656 13682683 C to T
FTB66657 13686414 G to A
FTB66658 13687582 T to C
FTB66659 13687927 C to A
FTB66660 13704502 A to T
FTB66661 13713287 C to T
FTB66662 13717514 C to T
FTB66663 13756297 C to A
FTB66664 13756719 A to C
FTB66665 13797690 A to G
FTB66666 13802244 A to T
FTB66667 13804319 A to G
FTB66668 13811110 A to T
FTB66669 13813863 C to T
FTB66670 13814187 T to A
FTB66671 13820419 C to A
FTB66672 13833209 A to G
FTB66673 13836731 G to T
FTB66674 13851802 G to C
FTB66675 13852000 G to T
FTB66676 13854838 A to G
FTB66677 13859629 T to C
FTB66678 13861718 C to T
FTB66679 13870791 C to T
FTB66680 13871145 A to T
FTB66681 13879441 A to G
FTB66682 13880820 G to C
FTB66683 13886664 G to T
FTB66684 13889158 G to T
FTB66685 13889800 G to A
FTB66686 13893015 C to A
FTB66687 13893163 G to T
FTB66688 13894602 A to C
FTB66689 13897928 A to C
FTB66690 13899915 G to T
FTB66691 13902739 G to A
FTB66692 13903853 T to C
FTB66693 13909433 G to C
FTB66694 13947084 T to C
FTB66695 13959934 C to T
FTB66696 13972357 G to T
FTB66697 13977402 C to A
FTB66698 13981417 A to G
FTB66699 14088029 G to T
FTB66700 14093963 A to T
FTB66701 14109969 T to C
FTB66702 14119135 A to G
FTB66703 14122319 T to C
FTB66704 14123638 T to C
FTB66705 14125789 A to T
FTB66706 14128234 A to C
FTB66707 14138827 G to A
FTB66708 14157190 A to G
FTB66709 14165687 G to C
FTB66710 14171383 T to C
FTB66711 14176010 T to C
FTB66712 14176623 G to A
FTB66713 14184349 G to A
FTB66714 14189923 T to C
FTB66715 14214869 A to G
FTB66716 14217219 G to A
FTB66717 14226790 A to C
FTB66718 14229951 A to G
FTB66719 14233749 T to G
FTB66720 14245393 T to A
FTB66721 14250314 A to C
FTB66722 14259268 A to G
FTB66723 14261684 C to T
FTB66724 14270201 T to C
FTB66725 14295199 A to G
FTB66726 14295765 G to A
FTB66727 14307997 C to T
FTB66728 14310861 C to G
FTB66729 14310897 T to C
FTB66730 14311211 G to T
FTB66731 14315987 A to G
FTB66732 14316326 G to A
FTB66733 14316740 G to T
FTB66734 14317345 A to T
FTB66735 14326394 A to G
FTB66736 14326627 T to C
FTB66737 14341041 A to T
FTB66738 14346811 C to T
FTB66739 14348937 G to C
FTB66740 14351777 G to A
FTB66741 14352993 A to G
FTB66742 14354340 T to C
FTB66743 14355026 G to A
FTB66744 14365551 A to G
FTB66745 14382508 T to G
FTB66746 14399515 C to A
FTB66747 14408396 T to C
FTB66748 14418975 G to A
FTB66749 14429844 C to T
FTB66750 14442275 C to T
FTB66751 14447920 G to T
FTB66752 14448285 T to C
FTB66753 14448477 T to C
FTB66754 14460036 A to C
FTB66755 14460470 A to T
FTB66756 14477751 T to C
FTB66757 14490827 G to A
FTB66758 14491820 A to G
FTB66759 14494673 C to T
FTB66760 14503882 G to C
FTB66761 14505706 T to G
FTB66762 14509544 C to A
FTB66763 14510173 T to C
FTB66764 14518133 C to T
FTB66765 14524435 C to A
FTB66766 14527977 C to T
FTB66767 14529572 A to G
FTB66768 14531092 T to A
FTB66769 14535139 C to G
FTB66770 14535544 A to T
FTB66771 14548344 A to G
FTB66772 14550808 A to G
FTB66773 14557464 G to A
FTB66774 14559545 A to T
FTB66775 14561025 T to C
FTB66776 14575994 C to A
FTB66777 14577474 A to G
FTB66778 14581387 G to A
FTB66779 14583946 G to T
FTB66780 14592345 G to T
FTB66781 14596779 A to G
FTB66782 14596784 T to C
FTB66783 14598147 C to T
FTB66784 14607403 G to A
FTB66785 14608725 T to C
FTB66786 14610863 G to A
FTB66787 14624343 C to T
FTB66788 14638935 T to G
FTB66789 14642820 G to A
FTB66790 14645902 T to C
FTB66791 14650667 A to G
FTB66792 14658247 A to G
FTB66793 14659664 T to A
FTB66794 14676150 G to A
FTB66795 14683974 C to T
FTB66796 14685345 A to G
FTB66797 14710652 C to A
FTB66798 14712048 G to A
FTB66799 14713190 T to C
FTB66800 14715601 G to A
FTB66801 14721497 A to C
FTB66802 14729929 T to C
FTB66803 14734732 G to A
FTB66804 14738328 G to T
FTB66805 14739829 G to A
FTB66806 14746182 G to A
FTB66807 14749691 C to G
FTB66808 14755564 C to A
FTB66809 14767387 T to C
FTB66810 14770533 A to G
FTB66811 14772934 T to C
FTB66812 14780400 C to A
FTB66813 14787379 C to T
FTB66814 14787809 T to C
FTB66815 14797648 G to A
FTB66816 14810227 T to C
FTB66817 14815857 T to C
FTB66818 14816093 C to T
FTB66819 14840896 G to T
FTB66820 14844637 T to C
FTB66821 14847741 C to T
FTB66822 14848750 C to A
FTB66823 14859082 T to A
FTB66824 14870571 C to T
FTB66825 14872468 T to C
FTB66826 14877133 G to A
FTB66827 14889030 A to G
FTB66828 14892537 C to G
FTB66829 14899563 G to A
FTB66830 14909299 T to C
FTB66831 14921218 G to A
FTB66832 14921723 G to C
FTB66833 14922547 T to C
FTB66834 14926813 C to A
FTB66835 14928160 A to G
FTB66836 14928651 A to C
FTB66837 14944146 T to G
FTB66838 14946484 A to C
FTB66839 14952181 T to C
FTB66840 14960170 G to A
FTB66841 14968464 G to A
FTB66842 14971296 C to T
FTB66843 14992511 C to T
FTB66844 14994950 T to A
FTB66845 15010422 C to T
FTB66846 15021834 G to T
FTB66847 15024094 A to C
FTB66848 15024098 T to C
FTB66849 15039146 G to T
FTB66850 15039228 T to G
FTB66851 15039488 C to T
FTB66852 15039534 T to A
FTB66853 15071503 A to G
FTB66854 15072050 T to C
FTB66855 15072231 C to T
FTB66856 15084304 A to T
FTB66857 15091759 T to C
FTB66858 15093123 C to G
FTB66859 15097082 T to C
FTB66860 15099528 A to G
FTB66861 15104770 T to G
FTB66862 15105232 T to C
FTB66863 15105969 C to T
FTB66864 15112829 C to G
FTB66865 15126920 T to C
FTB66866 15130990 C to T
FTB66867 15132999 A to G
FTB66868 15137827 G to A
FTB66869 15143098 C to A
FTB66870 15166812 T to C
FTB66871 15169916 A to T
FTB66872 15171487 T to C
FTB66873 15180121 G to A
FTB66874 15187156 T to C
FTB66875 15192462 T to C
FTB66876 15199299 C to A
FTB66877 15200787 A to G
FTB66878 15205205 A to C
FTB66879 15211078 G to A
FTB66880 15211652 G to A
FTB66881 15212138 G to C
FTB66882 15212163 G to A
FTB66883 15214282 T to G
FTB66884 15216887 C to A
FTB66885 15229594 C to T
FTB66886 15231338 G to T
FTB66887 15240171 C to T
FTB66888 15243757 G to A
FTB66889 15255725 C to G
FTB66890 15257793 T to C
FTB66891 15258025 A to G
FTB66892 15260007 C to T
FTB66893 15267566 C to A
FTB66894 15271251 C to A
FTB66895 15272762 G to T
FTB66896 15276096 G to T
FTB66897 15277545 C to A
FTB66898 15282317 C to T
FTB66899 15283218 C to G
FTB66900 15288720 A to G
FTB66901 15288846 C to G
FTB66902 15313205 C to A
FTB66903 15316530 C to T
FTB66904 15323033 C to T
FTB66905 15323142 G to A
FTB66906 15325789 A to G
FTB66907 15328800 T to C
FTB66908 15330761 C to T
FTB66909 15332874 T to C
FTB66910 15335046 C to A
FTB66911 15338760 G to A
FTB66912 15339815 G to T
FTB66913 15350327 T to C
FTB66914 15356743 T to C
FTB66915 15366582 G to C
FTB66916 15367672 C to T
FTB66917 15369669 A to G
FTB66918 15382311 G to T
FTB66919 15388131 G to A
FTB66920 15390578 A to C
FTB66921 15405171 G to A
FTB66922 15414903 G to C
FTB66923 15424095 C to A
FTB66924 15433333 C to T
FTB66925 15439068 A to G
FTB66926 15451723 G to A
FTB66927 15455946 C to A
FTB66928 15463143 A to G
FTB66929 15467918 G to C
FTB66930 15470901 C to A
FTB66931 15478689 G to C
FTB66932 15480469 T to A
FTB66933 15487527 A to G
FTB66934 15494120 T to C
FTB66935 15494480 G to A
FTB66936 15499144 C to A
FTB66937 15507362 G to A
FTB66938 15508846 C to T
FTB66939 15513546 G to T
FTB66940 15526154 C to G
FTB66941 15540402 A to G
FTB66942 15543241 A to G
FTB66943 15545099 C to A
FTB66944 15546351 G to A
FTB66945 15547622 T to G
FTB66946 15557858 T to C
FTB66947 15558353 T to C
FTB66948 15564713 T to G
FTB66949 15564895 G to A
FTB66950 15573578 C to T
FTB66951 15580616 T to C
FTB66952 15582036 C to G
FTB66953 15592858 G to A
FTB66954 15601041 G to A
FTB66955 15619854 C to A
FTB66956 15625954 A to G
FTB66957 15630116 G to T
FTB66958 15632061 G to A
FTB66959 15637534 G to C
FTB66960 15638383 G to A
FTB66961 15639929 G to A
FTB66962 15641706 G to A
FTB66963 15651394 C to T
FTB66964 15652429 T to C
FTB66965 15652650 G to C
FTB66966 15660722 C to T
FTB66967 15668375 A to G
FTB66968 15678725 C to G
FTB66969 15680926 T to C
FTB66970 15683222 A to C
FTB66971 15683700 C to T
FTB66972 15685876 A to G
FTB66973 15688743 C to T
FTB66974 15700293 T to C
FTB66975 15703305 T to C
FTB66976 15705895 A to T
FTB66977 15720534 G to A
FTB66978 15728909 T to G
FTB66979 15732361 A to G
FTB66980 15741259 G to A
FTB66981 15741985 G to C
FTB66982 15749576 C to A
FTB66983 15752252 T to C
FTB66984 15754588 C to T
FTB66985 15758925 G to A
FTB66986 15760834 G to A
FTB66987 15770638 A to C
FTB66988 15771604 C to T
FTB66989 15776245 A to G
FTB66990 15777462 G to A
FTB66991 15783813 C to A
FTB66992 15794111 G to T
FTB66993 15795090 C to T
FTB66994 15795707 T to C
FTB66995 15799080 T to C
FTB66996 15804377 C to T
FTB66997 15810002 G to T
FTB66998 15810123 A to G
FTB66999 15813502 T to A
FTB67000 15820837 G to C
FTB67001 15826278 C to G
FTB67002 15834069 C to T
FTB67003 15836576 T to G
FTB67004 15837943 A to G
FTB67005 15839618 T to C
FTB67006 15856118 C to A
FTB67007 15862003 C to T
FTB67008 15862170 C to A
FTB67009 15862879 C to G
FTB67010 15864425 T to A
FTB67011 15864577 A to T
FTB67012 15893625 T to C
FTB67013 15893631 T to C
FTB67014 15908465 G to C
FTB67015 15910226 A to G
FTB67016 15925095 G to T
FTB67017 15949414 G to A
FTB67018 15955394 G to A
FTB67019 15965404 C to G
FTB67020 15966078 G to A
FTB67021 15968626 T to A
FTB67022 15975773 G to A
FTB67023 15975997 A to G
FTB67024 15980466 T to A
FTB67025 15980999 T to C
FTB67026 15985678 C to A
FTB67027 15988993 C to T
FTB67028 15991734 C to T
FTB67029 15992066 A to T
FTB67030 15993735 G to T
FTB67031 15995888 A to T
FTB67032 15996190 C to G
FTB67033 15999556 C to G
FTB67034 16013192 C to T
FTB67035 16018033 C to A
FTB67036 16018127 G to T
FTB67037 16018639 G to A
FTB67038 16018711 C to T
FTB67039 16039598 T to C
FTB67040 16039661 G to T
FTB67041 16052358 G to A
FTB67042 16059277 T to C
FTB67043 16063831 G to A
FTB67044 16065004 C to T
FTB67045 16076642 A to G
FTB67046 16081420 C to T
FTB67047 16084758 T to G
FTB67048 16093316 T to C
FTB67049 16099721 A to C
FTB67050 16106904 A to T
FTB67051 16110269 C to G
FTB67052 16132117 T to C
FTB67053 16135067 G to A
FTB67054 16142895 T to C
FTB67055 16144725 G to C
FTB67056 16146908 A to T
FTB67057 16151929 C to T
FTB67058 16273049 C to A
FTB67059 16283356 C to T
FTB67060 16286215 T to C
FTB67061 16295401 G to A
FTB67062 16298050 C to G
FTB67063 16298814 T to C
FTB67064 16301101 A to G
FTB67065 16303009 C to A
FTB67066 16305708 G to A
FTB67067 16437482 C to T
FTB67068 16448107 A to C
FTB67069 16448109 C to T
FTB67070 16450397 G to A
FTB67071 16457870 G to A
FTB67072 16489538 T to C
FTB67073 16499157 T to A
FTB67074 16504190 A to G
FTB67075 16508396 C to T
FTB67076 16516477 G to A
FTB67077 16526793 T to C
FTB67078 16531081 A to G
FTB67079 16531552 C to A
FTB67080 16536345 G to T
FTB67081 16536815 T to A
FTB67082 16544277 A to G
FTB67083 16546953 T to G
FTB67084 16553076 T to C
FTB67085 16558548 A to G
FTB67086 16560277 C to T
FTB67087 16574379 T to C
FTB67088 16576211 T to C
FTB67089 16584008 A to C
FTB67090 16589187 C to T
FTB67091 16597324 T to C
FTB67092 16597615 A to G
FTB67093 16632386 A to G
FTB67094 16633795 T to C
FTB67095 16635130 C to G
FTB67096 16636322 T to C
FTB67097 16639144 T to C
FTB67098 16639323 G to A
FTB67099 16640492 C to G
FTB67100 16644690 G to A
FTB67101 16645589 T to C
FTB67102 16650257 T to G
FTB67103 16651762 G to C
FTB67104 16655481 T to C
FTB67105 16666272 C to T
FTB67106 16700627 T to C
FTB67107 16720661 C to T
FTB67108 16727919 C to T
FTB67109 16745499 T to C
FTB67110 16745520 C to T
FTB67111 16750777 G to A
FTB67112 16752410 C to T
FTB67113 16753984 T to A
FTB67114 16759110 T to C
FTB67115 16772091 T to C
FTB67116 16791097 T to G
FTB67117 16791751 C to T
FTB67118 16810666 T to C
FTB67119 16817167 T to C
FTB67120 16825145 T to A
FTB67121 16826919 C to T
FTB67122 16833668 G to T
FTB67123 16836794 A to C
FTB67124 16849520 T to C
FTB67125 16850128 T to C
FTB67126 16864824 C to T
FTB67127 16867701 G to C
FTB67128 16880098 G to A
FTB67129 16884564 C to A
FTB67130 16884620 T to C
FTB67131 16894215 C to A
FTB67132 16909689 T to G
FTB67133 16912490 C to T
FTB67134 16919191 A to C
FTB67135 16921426 C to G
FTB67136 16930697 G to T
FTB67137 16931652 G to A
FTB67138 16932793 G to A
FTB67139 16939886 C to A
FTB67140 16950685 C to T
FTB67141 16951476 G to T
FTB67142 16952691 G to T
FTB67143 16954947 C to A
FTB67144 16956301 T to C
FTB67145 16957557 G to A
FTB67146 16960600 G to A
FTB67147 16963183 A to T
FTB67148 16966938 C to T
FTB67149 16982049 G to A
FTB67150 16992835 G to A
FTB67151 16993807 G to T
FTB67152 16995476 T to C
FTB67153 16999097 C to T
FTB67154 16999286 G to C
FTB67155 17007536 A to G
FTB67156 17016292 A to G
FTB67157 17042901 A to T
FTB67158 17043178 G to C
FTB67159 17045073 G to T
FTB67160 17053492 A to C
FTB67161 17056419 A to G
FTB67162 17067291 T to C
FTB67163 17070489 A to C
FTB67164 17076224 G to T
FTB67165 17080036 G to T
FTB67166 17080634 A to T
FTB67167 17101052 T to A
FTB67168 17102310 C to T
FTB67169 17102642 T to C
FTB67170 17108793 T to A
FTB67171 17108875 G to A
FTB67172 17111861 A to T
FTB67173 17122462 C to T
FTB67174 17126945 G to A
FTB67175 17129472 G to A
FTB67176 17132884 C to T
FTB67177 17135805 C to T
FTB67178 17136652 C to T
FTB67179 17139997 T to G
FTB67180 17148082 C to A
FTB67181 17170631 A to T
FTB67182 17184207 C to A
FTB67183 17186578 G to A
FTB67184 17187206 C to T
FTB67185 17189392 C to T
FTB67186 17190713 C to A
FTB67187 17192644 A to C
FTB67188 17196234 T to C
FTB67189 17200556 G to T
FTB67190 17239781 A to C
FTB67191 17240253 T to C
FTB67192 17240697 C to T
FTB67193 17247500 G to A
FTB67194 17251240 T to A
FTB67195 17251241 C to A
FTB67196 17256822 A to G
FTB67197 17261313 A to T
FTB67198 17262249 T to C
FTB67199 17287917 G to T
FTB67200 17299816 G to A
FTB67201 17300902 C to A
FTB67202 17306859 C to T
FTB67203 17307562 C to A
FTB67204 17319806 A to G
FTB67205 17326158 A to G
FTB67206 17326383 G to C
FTB67207 17326837 G to A
FTB67208 17327084 T to C
FTB67209 17328925 A to G
FTB67210 17329660 T to A
FTB67211 17329661 G to T
FTB67212 17329981 C to T
FTB67213 17330535 G to C
FTB67214 17334484 G to A
FTB67215 17334703 A to T
FTB67216 17338790 T to A
FTB67217 17338852 G to C
FTB67218 17351684 C to T
FTB67219 17352799 T to G
FTB67220 17358741 A to T
FTB67221 17358771 T to C
FTB67222 17365391 A to G
FTB67223 17370666 A to C
FTB67224 17374879 T to G
FTB67225 17379601 G to C
FTB67226 17389464 A to G
FTB67227 17394505 A to C
FTB67228 17398711 T to C
FTB67229 17409455 G to C
FTB67230 17411815 T to G
FTB67231 17419414 G to T
FTB67232 17425229 C to A
FTB67233 17426101 G to T
FTB67234 17452670 C to T
FTB67235 18643774 T to A
FTB67236 18655793 C to G
FTB67237 18659341 C to G
FTB67238 18666191 G to T
FTB67239 18667299 G to A
FTB67240 18667889 T to C
FTB67241 18874072 T to A
FTB67242 18877510 C to A
FTB67243 18880216 C to A
FTB67244 18881333 T to C
FTB67245 18881453 C to A
FTB67246 18882276 T to C
FTB67247 18888214 T to A
FTB67248 18891288 C to T
FTB67249 18913774 C to T
FTB67250 18915053 A to G
FTB67251 18920086 C to T
FTB67252 18935101 C to A
FTB67253 18949131 T to C
FTB67254 18954669 T to C
FTB67255 18962433 A to T
FTB67256 18968211 A to C
FTB67257 18969641 T to C
FTB67258 18975270 G to T
FTB67259 18995055 T to G
FTB67260 18995085 A to G
FTB67261 18997514 T to A
FTB67262 19000398 A to G
FTB67263 19003792 G to T
FTB67264 19003968 A to G
FTB67265 19005166 T to G
FTB67266 19017075 A to G
FTB67267 19023603 A to T
FTB67268 19023823 C to T
FTB67269 19029947 G to T
FTB67270 19042047 A to C
FTB67271 19049158 G to A
FTB67272 19060437 C to T
FTB67273 19063213 A to G
FTB67274 19081510 C to A
FTB67275 19087059 G to A
FTB67276 19092167 G to C
FTB67277 19094047 G to T
FTB67278 19096781 G to A
FTB67279 19104782 T to G
FTB67280 19109063 C to A
FTB67281 19121903 C to T
FTB67282 19124350 G to A
FTB67283 19127909 G to A
FTB67284 19132609 T to G
FTB67285 19133590 C to A
FTB67286 19136024 G to T
FTB67287 19137420 C to A
FTB67288 19140897 C to T
FTB67289 19145325 T to G
FTB67290 19145820 G to A
FTB67291 19150257 T to C
FTB67292 19153811 T to G
FTB67293 19155668 G to T
FTB67294 19155832 G to A
FTB67295 19159028 A to T
FTB67296 19165225 C to T
FTB67297 19166064 T to C
FTB67298 19167012 T to C
FTB67299 19168518 A to C
FTB67300 19170201 C to G
FTB67301 19173933 A to G
FTB67302 19181736 G to A
FTB67303 19193710 A to T
FTB67304 19199974 A to G
FTB67305 19200036 C to T
FTB67306 19201524 C to T
FTB67307 19205530 C to T
FTB67308 19208898 C to A
FTB67309 19211031 C to T
FTB67310 19219461 T to A
FTB67311 19220855 G to A
FTB67312 19227967 A to G
FTB67313 19229698 C to T
FTB67314 19235286 C to T
FTB67315 19244996 C to T
FTB67316 19260757 T to C
FTB67317 19261407 A to G
FTB67318 19268974 C to T
FTB67319 19269298 T to C
FTB67320 19271321 A to G
FTB67321 19278888 A to C
FTB67322 19289408 A to G
FTB67323 19292605 G to A
FTB67324 19301374 G to A
FTB67325 19302287 A to T
FTB67326 19315429 C to G
FTB67327 19317431 A to G
FTB67328 19320513 G to T
FTB67329 19323460 T to C
FTB67330 19324685 A to G
FTB67331 19326716 A to G
FTB67332 19327513 C to A
FTB67333 19332134 T to G
FTB67334 19341867 G to T
FTB67335 19344738 G to C
FTB67336 19358946 T to A
FTB67337 19363015 C to G
FTB67338 19364659 A to C
FTB67339 19367958 A to G
FTB67340 19368368 T to C
FTB67341 19385166 T to C
FTB67342 19387310 T to A
FTB67343 19391120 G to C
FTB67344 19393894 T to C
FTB67345 19397306 A to G
FTB67346 19405055 A to G
FTB67347 19405458 G to T
FTB67348 19425407 G to C
FTB67349 19426199 G to A
FTB67350 19433742 C to T
FTB67351 19434006 T to C
FTB67352 19436018 G to A
FTB67353 19443135 T to C
FTB67354 19475766 C to T
FTB67355 19482039 G to A
FTB67356 19502752 C to T
FTB67357 19516322 A to G
FTB67358 19519808 G to T
FTB67359 19520279 C to T
FTB67360 19523032 A to T
FTB67361 19528850 C to T
FTB67362 19534281 G to T
FTB67363 19536602 C to G
FTB67364 19536609 G to A
FTB67365 19568421 A to G
FTB67366 19604318 C to G
FTB67367 19605958 T to A
FTB67368 19611833 A to G
FTB67369 19614534 C to T
FTB67370 19617592 G to A
FTB67371 19621451 T to C
FTB67372 19631537 G to A
FTB67373 19634691 T to G
FTB67374 19640772 T to C
FTB67375 19645890 C to T
FTB67376 19648133 G to A
FTB67377 19648435 C to T
FTB67378 19648828 C to T
FTB67379 19652459 T to C
FTB67380 19657553 T to C
FTB67381 19666379 C to T
FTB67382 19669712 A to G
FTB67383 19671299 G to T
FTB67384 19678090 T to C
FTB67385 19683934 A to C
FTB67386 19695221 A to G
FTB67387 19698384 C to A
FTB67388 19705992 C to T
FTB67389 19715288 C to T
FTB67390 19716223 T to C
FTB67391 19719116 G to A
FTB67392 19722539 T to C
FTB67393 19735749 G to C
FTB67394 19749507 A to G
FTB67395 19760068 A to G
FTB67396 19769942 G to C
FTB67397 19776196 T to C
FTB67398 19786573 G to A
FTB67399 19793982 T to C
FTB67400 19799923 T to C
FTB67401 19810012 G to A
FTB67402 19810442 C to T
FTB67403 19810457 G to A
FTB67404 19823337 G to C
FTB67405 19830515 A to T
FTB67406 19833481 T to C
FTB67407 19860379 A to C
FTB67408 19861131 C to T
FTB67409 19863420 G to C
FTB67410 19865204 A to G
FTB67411 19866797 C to A
FTB67412 19870612 G to A
FTB67413 19890856 A to C
FTB67414 19905227 C to G
FTB67415 19905544 T to A
FTB67416 19912686 A to G
FTB67417 19917581 C to T
FTB67418 19919909 G to C
FTB67419 19927361 A to G
FTB67420 19931510 A to C
FTB67421 19948344 G to T
FTB67422 19953596 G to A
FTB67423 19966772 C to A
FTB67424 19969067 A to G
FTB67425 19972821 A to G
FTB67426 19983201 A to G
FTB67427 19987480 A to T
FTB67428 19987769 C to G
FTB67429 19993285 C to T
FTB67430 19993405 A to T
FTB67431 20001672 A to T
FTB67432 20006915 A to G
FTB67433 20014183 T to A
FTB67434 20016188 G to T
FTB67435 20025485 T to C
FTB67436 20030887 T to C
FTB67437 20037623 C to A
FTB67438 20044445 G to T
FTB67439 20044594 T to C
FTB67440 20051115 G to A
FTB67441 20051958 T to A
FTB67442 20355032 C to A
FTB67443 20355442 C to A
FTB67444 20361585 A to T
FTB67445 20367140 T to A
FTB67446 20388149 G to A
FTB67447 20398445 T to C
FTB67448 20401447 C to T
FTB67449 20403916 G to A
FTB67450 20409786 C to T
FTB67451 20424193 G to A
FTB67452 20424500 C to T
FTB67453 20427481 A to G
FTB67454 20434524 T to A
FTB67455 20469925 T to C
FTB67456 20470983 G to T
FTB67457 20476614 T to C
FTB67458 20484334 T to G
FTB67459 20484502 C to T
FTB67460 20484891 C to T
FTB67461 20497055 C to T
FTB67462 20499612 T to C
FTB67463 20500564 T to C
FTB67464 20502433 G to C
FTB67465 20522599 T to G
FTB67466 20523139 A to T
FTB67467 20539885 T to C
FTB67468 20543567 C to T
FTB67469 20547900 A to C
FTB67470 20549257 T to C
FTB67471 20556052 A to G
FTB67472 20557034 T to G
FTB67473 20559858 G to A
FTB67474 20561929 C to G
FTB67475 20563051 G to C
FTB67476 20566351 T to A
FTB67477 20598381 A to G
FTB67478 20601576 A to C
FTB67479 20605713 A to G
FTB67480 20620451 G to A
FTB67481 20621224 A to T
FTB67482 20634159 G to C
FTB67483 20638285 T to A
FTB67484 20646624 A to G
FTB67485 20647584 C to T
FTB67486 20660387 G to A
FTB67487 20665146 C to T
FTB67488 20710855 T to C
FTB67489 20722293 A to G
FTB67490 20734424 G to A
FTB67491 20744533 A to G
FTB67492 20747911 A to G
FTB67493 20750502 G to A
FTB67494 20753359 A to C
FTB67495 20756979 C to T
FTB67496 20770319 G to A
FTB67497 20795471 T to G
FTB67498 20798789 C to T
FTB67499 20803197 C to A
FTB67500 20803543 C to A
FTB67501 20805415 C to G
FTB67502 20812344 T to G
FTB67503 20828204 G to A
FTB67504 20832063 A to T
FTB67505 20838390 C to T
FTB67506 20838767 G to A
FTB67507 20839119 C to T
FTB67508 20858202 A to G
FTB67509 20861720 C to T
FTB67510 20861955 T to C
FTB67511 20863250 A to G
FTB67512 20864380 G to A
FTB67513 20865385 C to G
FTB67514 20878028 C to A
FTB67515 20884494 C to G
FTB67516 20885247 T to C
FTB67517 20885486 C to T
FTB67518 20885716 T to A
FTB67519 20887951 T to G
FTB67520 20890657 C to T
FTB67521 20892592 C to T
FTB67522 20904659 T to C
FTB67523 20909859 A to T
FTB67524 20917710 C to T
FTB67525 20928754 A to T
FTB67526 20933211 A to G
FTB67527 20953137 A to G
FTB67528 20955943 G to A
FTB67529 20956304 G to C
FTB67530 20956578 G to A
FTB67531 20956918 T to C
FTB67532 20957714 C to A
FTB67533 20960373 C to A
FTB67534 20967434 G to A
FTB67535 20968683 T to A
FTB67536 20971159 A to T
FTB67537 20974940 G to A
FTB67538 20976385 T to C
FTB67539 20978065 T to C
FTB67540 20979131 G to C
FTB67541 20982231 G to C
FTB67542 20988338 A to G
FTB67543 20989278 G to A
FTB67544 21005500 C to A
FTB67545 21022243 C to A
FTB67546 21025342 G to A
FTB67547 21028101 G to A
FTB67548 21043025 G to T
FTB67549 21069671 T to C
FTB67550 21069771 T to C
FTB67551 21073523 C to T
FTB67552 21077553 C to A
FTB67553 21079973 C to A
FTB67554 21081432 A to G
FTB67555 21097134 G to T
FTB67556 21100092 T to A
FTB67557 21105941 A to G
FTB67558 21107604 C to A
FTB67559 21108792 A to G
FTB67560 21110558 G to C
FTB67561 21120037 G to A
FTB67562 21120385 G to A
FTB67563 21137826 G to C
FTB67564 21142952 C to A
FTB67565 21149250 C to G
FTB67566 21155542 G to T
FTB67567 21169234 A to G
FTB67568 21169570 A to C
FTB67569 21173155 C to T
FTB67570 21191219 G to T
FTB67571 21198297 T to C
FTB67572 21205025 C to T
FTB67573 21218892 T to G
FTB67574 21222733 C to A
FTB67575 21223957 A to G
FTB67576 21224661 T to A
FTB67577 21231451 A to G
FTB67578 21236029 T to G
FTB67579 21241214 T to A
FTB67580 21245999 T to A
FTB67581 21265947 T to C
FTB67582 21268687 C to G
FTB67583 21275008 G to A
FTB67584 21289565 A to G
FTB67585 21299092 T to C
FTB67586 21300029 C to T
FTB67587 21311623 T to C
FTB67588 21314093 A to T
FTB67589 21314188 A to T
FTB67590 21318318 A to T
FTB67591 21323363 C to T
FTB67592 21326375 A to G
FTB67593 21331725 C to A
FTB67594 21332233 G to A
FTB67595 21340404 A to G
FTB67596 21347806 G to C
FTB67597 21363252 C to T
FTB67598 21363665 A to C
FTB67599 21387580 A to G
FTB67600 21389043 T to A
FTB67601 21391021 T to A
FTB67602 21400301 A to T
FTB67603 21413533 A to G
FTB67604 21413926 G to A
FTB67605 21444441 T to C
FTB67606 21462204 A to G
FTB67607 21463733 A to G
FTB67608 21468503 G to A
FTB67609 21473527 G to T
FTB67610 21586999 A to G
FTB67611 21589864 G to A
FTB67612 21597211 C to G
FTB67613 21599289 T to C
FTB67614 21601277 A to T
FTB67615 21617243 G to T
FTB67616 21618220 G to A
FTB67617 21620713 C to A
FTB67618 21645851 G to A
FTB67619 21653593 T to C
FTB67620 21660262 T to A
FTB67621 21662416 C to T
FTB67622 21667945 T to G
FTB67623 21670593 A to G
FTB67624 21672842 T to A
FTB67625 21680911 C to T
FTB67626 21686751 C to A
FTB67627 21686752 T to A
FTB67628 21693032 A to G
FTB67629 21694773 G to A
FTB67630 21696326 C to G
FTB67631 21705146 A to T
FTB67632 21710603 G to C
FTB67633 21711000 C to T
FTB67634 21714504 T to C
FTB67635 21815505 G to T
FTB67636 21824905 C to T
FTB67637 21837726 G to T
FTB67638 21843808 T to C
FTB67639 22236862 A to G
FTB67640 22238482 G to A
FTB67641 22242673 A to C
FTB67642 22247187 A to C
FTB67643 22249826 A to G
FTB67644 22256758 G to T
FTB67645 22260169 A to G
FTB67646 22263399 T to C
FTB67647 22263635 T to A
FTB67648 22269728 G to A
FTB67649 22278294 C to G
FTB67650 22279345 C to T
FTB67651 22280710 T to C
FTB67652 22324880 A to G
FTB67653 22334323 G to A
FTB67654 26323042 C to A
FTB67655 26329275 T to C
FTB67656 26330018 A to G
FTB67657 26331142 T to G
FTB67658 26337854 C to T
FTB67659 26345881 G to T
FTB67660 26348349 A to G
FTB67661 26361275 C to T
FTB67662 26363123 T to C
FTB67663 26366505 C to T
FTB67664 26368337 T to C
FTB67665 26371928 C to A
FTB67666 26372196 T to C
FTB67667 26376582 C to A
FTB67668 26377968 G to A
FTB67669 26382871 C to T
FTB67670 26388442 C to T
FTB67671 26391003 T to C
FTB67672 26397837 T to C
FTB67673 26399320 G to A
FTB67674 26408542 C to A
FTB67675 26413416 A to G
FTB67676 26413980 G to A
FTB67677 26416608 G to A
FTB67678 26422379 A to G
FTB67679 26440191 C to T
FTB67680 26453575 T to A
FTB67681 26459776 T to A
FTB67682 26475050 C to T
FTB67683 26488465 T to C
FTB67684 26489242 A to T
FTB67685 26500573 A to G
FTB67686 26501508 A to G
FTB67687 26502973 A to G
FTB67688 26504453 A to G
FTB67689 26515196 C to G
FTB67690 26519365 T to C
FTB67691 26526121 G to A
FTB67692 26526122 T to A
FTB67693 26526124 C to G
FTB67694 26534683 G to A
FTB67695 26542399 G to T
FTB67696 26547435 T to C
FTB67697 26549689 C to T
FTB67698 26551944 C to T
FTB67699 26558218 A to G
FTB67700 26565001 C to G
FTB67701 26573066 C to T
FTB67702 26574651 A to G
FTB67703 26578440 C to T
FTB67704 26582714 A to C
FTB67705 26583555 T to C
FTB67706 26593513 G to A
FTB67707 26594387 G to A
FTB67708 26598274 A to G
FTB67709 26602253 C to T
FTB67710 26610808 G to A
FTB67711 26619195 T to C
FTB67712 11138400 T to G
FTB67713 10822575 C to T
FTB67714 10841117 C to T
FTB67715 10847174 G to T
FTB67716 10801413 G to A
FTB67717 11485440 C to T
FTB67718 11445180 C to T
FTB67719 11669564 G to T
FTB67720 10914345 C to G
FTB67721 10231679 A to G
FTB67722 10812135 C to G
FTB67723 10820024 A to C
FTB67724 10883170 A to G
FTB67725 10934170 G to T
FTB67726 10984605 C to A
FTB67727 11643593 A to T
FTB67728 11663608 A to G
FTB67729 11671738 A to C
FTB67730 10084106 C to T
FTB67731 10885345 C to T
FTB67732 11006452 T to C
FTB67733 3071454 A to G
FTB67734 2781739 G to A
FTB67735 3063604 G to A
FTB67736 3072889 T to C
FTB67737 3084708 A to G
FTB67738 3098614 A to G
FTB67739 3102274 T to C
FTB67740 3108499 C to A
FTB67741 3111857 T to G
FTB67742 3114274 A to G
FTB67743 3115199 A to C
FTB67744 3129551 A to G
FTB67745 3145732 G to A
FTB67746 3153383 C to T
FTB67747 3160592 T to C
FTB67748 3166112 C to A
FTB67749 3171145 A to G
FTB67750 3174680 T to C
FTB67751 3174758 C to T
FTB67752 3193867 C to T
FTB67753 3204343 A to G
FTB67754 3215489 T to C
FTB67755 3221731 G to T
FTB67756 3225944 T to A
FTB67757 3235823 A to G
FTB67758 3238741 C to G
FTB67759 3242602 C to T
FTB67760 3242915 A to T
FTB67761 3247388 T to C
FTB67762 3248781 C to T
FTB67763 3254892 C to T
FTB67764 3254916 A to T
FTB67765 3255518 G to C
FTB67766 3258754 C to T
FTB67767 3260123 G to A
FTB67768 3284349 T to C
FTB67769 3293084 A to G
FTB67770 3298484 A to G
FTB67771 3307448 A to G
FTB67772 3308524 T to C
FTB67773 3330252 C to T
FTB67774 3341420 A to C
FTB67775 3345314 T to C
FTB67776 3361609 T to C
FTB67777 3371845 A to G
FTB67778 3374212 A to G
FTB67779 3375543 T to A
FTB67780 3401371 C to T
FTB67781 3406783 A to C
FTB67782 3415668 A to G
FTB67783 3427183 T to A
FTB67784 3452984 T to G
FTB67785 3453458 G to A
FTB67786 3456599 T to C
FTB67787 3460384 G to A
FTB67788 3471502 C to G
FTB67789 3473304 T to C
FTB67790 3482461 G to A
FTB67791 3496256 A to G
FTB67792 3500766 G to A
FTB67793 3513056 C to A
FTB67794 3514333 G to C
FTB67795 3516627 T to C
FTB67796 3518039 G to A
FTB67797 3519056 C to G
FTB67798 3522182 T to C
FTB67799 3527065 C to A
FTB67800 3529403 G to C
FTB67801 3538323 A to C
FTB67802 3546918 T to C
FTB67803 3549986 C to G
FTB67804 3565471 A to G
FTB67805 3568255 G to C
FTB67806 3571055 A to G
FTB67807 3576105 A to G
FTB67808 3584380 C to G
FTB67809 3596716 C to T
FTB67810 3605993 G to A
FTB67811 3606548 A to G
FTB67812 3630107 A to G
FTB67813 3633219 T to C
FTB67814 3639850 A to G
FTB67815 3643962 G to A
FTB67816 3648892 G to A
FTB67817 3650951 G to C
FTB67818 3651973 C to T
FTB67819 3664717 T to G
FTB67820 3676558 G to A
FTB67821 3678382 T to A
FTB67822 3679318 T to A
FTB67823 3683112 C to A
FTB67824 3689209 T to G
FTB67825 3692150 T to C
FTB67826 3693959 A to G
FTB67827 3717717 C to T
FTB67828 3726518 G to C
FTB67829 3729221 T to C
FTB67830 3734468 T to C
FTB67831 3738308 C to T
FTB67832 3744030 T to C
FTB67833 3747831 C to T
FTB67834 3749439 G to A
FTB67835 3760601 A to G
FTB67836 3770621 G to C
FTB67837 3776362 G to A
FTB67838 3782273 A to C
FTB67839 3785758 A to T
FTB67840 3789606 T to C
FTB67841 3791627 A to C
FTB67842 3796590 G to T
FTB67843 3813344 T to A
FTB67844 3815217 A to T
FTB67845 3820988 T to C
FTB67846 3832117 A to G
FTB67847 3833306 T to C
FTB67848 3848983 A to G
FTB67849 3862619 G to A
FTB67850 3880470 G to A
FTB67851 3883830 C to T
FTB67852 3897867 C to A
FTB67853 3913265 A to C
FTB67854 3913563 C to A
FTB67855 3921434 G to T
FTB67856 3934805 T to C
FTB67857 3936048 T to C
FTB67858 3962085 G to C
FTB67859 3985787 T to G
FTB67860 3989798 T to C
FTB67861 3991384 A to C
FTB67862 4015354 C to T
FTB67863 4021746 A to G
FTB67864 4024981 C to T
FTB67865 4027846 G to T
FTB67866 4032194 C to G
FTB67867 4032723 C to T
FTB67868 4039441 C to T
FTB67869 4043023 T to C
FTB67870 4052344 G to A
FTB67871 4067934 C to A
FTB67872 4069017 C to G
FTB67873 4071335 A to C
FTB67874 4074286 A to G
FTB67875 4074752 T to C
FTB67876 4086243 G to A
FTB67877 4089747 T to C
FTB67878 4091364 C to G
FTB67879 4092001 C to T
FTB67880 4097399 A to G
FTB67881 4101656 A to G
FTB67882 4109037 C to T
FTB67883 4113124 A to G
FTB67884 4113434 T to G
FTB67885 4113693 G to A
FTB67886 4116100 C to T
FTB67887 4118517 T to C
FTB67888 4134646 G to C
FTB67889 4134649 G to T
FTB67890 4136318 A to G
FTB67891 4136918 C to T
FTB67892 4137407 T to A
FTB67893 4138111 A to T
FTB67894 4144218 A to G
FTB67895 4199729 C to T
FTB67896 4210027 G to A
FTB67897 4235100 A to C
FTB67898 4248314 A to G
FTB67899 4252329 C to G
FTB67900 4253218 C to A
FTB67901 4288972 T to C
FTB67902 4290823 T to C
FTB67903 4294407 T to A
FTB67904 4298341 C to A
FTB67905 4302592 T to C
FTB67906 4304762 C to A
FTB67907 4307701 A to C
FTB67908 4308530 C to T
FTB67909 4315041 A to T
FTB67910 4321059 C to T
FTB67911 4332349 C to T
FTB67912 4337595 C to T
FTB67913 4338986 G to A
FTB67914 4340844 T to C
FTB67915 4342933 T to C
FTB67916 4345011 C to G
FTB67917 4355126 G to T
FTB67918 4364033 C to T
FTB67919 4367222 T to C
FTB67920 4367339 A to T
FTB67921 4382878 A to C
FTB67922 4386418 G to C
FTB67923 4390156 A to G
FTB67924 4396962 G to A
FTB67925 4404704 G to A
FTB67926 4437770 G to A
FTB67927 4478409 C to T
FTB67928 4479351 T to A
FTB67929 4486933 G to C
FTB67930 4500321 C to A
FTB67931 4510296 A to T
FTB67932 4518284 G to T
FTB67933 4521715 A to C
FTB67934 4524752 C to T
FTB67935 4529294 G to A
FTB67936 4529911 G to C
FTB67937 4530183 A to G
FTB67938 4562261 G to A
FTB67939 4571690 T to C
FTB67940 4574265 A to T
FTB67941 4590350 A to T
FTB67942 4620404 C to A
FTB67943 4639104 C to T
FTB67944 4640124 C to A
FTB67945 4642340 T to C
FTB67946 4662755 C to T
FTB67947 4665310 C to T
FTB67948 4669661 C to T
FTB67949 4674384 T to C
FTB67950 4690042 A to T
FTB67951 4695432 G to C
FTB67952 4698393 T to C
FTB67953 4702203 G to A
FTB67954 4706499 G to A
FTB67955 4730673 C to A
FTB67956 4779406 A to G
FTB67957 4787412 A to G
FTB67958 4795474 A to G
FTB67959 4799777 T to G
FTB67960 4825787 G to A
FTB67961 4834201 A to G
FTB67962 4835083 C to T
FTB67963 4844659 T to C
FTB67964 4848845 G to A
FTB67965 4852384 A to G
FTB67966 4859777 T to C
FTB67967 4866609 A to G
FTB67968 4872683 G to A
FTB67969 4879659 A to G
FTB67970 4879687 T to G
FTB67971 4880354 C to A
FTB67972 4884145 A to G
FTB67973 4886985 T to C
FTB67974 4888729 G to A
FTB67975 4888945 C to A
FTB67976 4892865 C to A
FTB67977 4907563 T to G
FTB67978 4909604 C to T
FTB67979 4938881 C to T
FTB67980 4940060 A to C
FTB67981 4961697 T to G
FTB67982 4967852 A to C
FTB67983 4969662 G to A
FTB67984 4980945 A to G
FTB67985 4991307 T to G
FTB67986 5004538 T to C
FTB67987 5009879 C to T
FTB67988 5013138 C to T
FTB67989 5017665 T to C
FTB67990 5019866 C to T
FTB67991 5025046 G to A
FTB67992 5046974 C to T
FTB67993 5049148 T to G
FTB67994 5052562 G to A
FTB67995 5071954 T to A
FTB67996 5089096 G to A
FTB67997 5096776 T to G
FTB67998 5107699 C to A
FTB67999 5108741 C to T
FTB68000 5112254 A to G
FTB68001 5124812 A to G
FTB68002 5134956 T to C
FTB68003 5140498 T to A
FTB68004 5146255 C to T
FTB68005 5147553 A to C
FTB68006 5158063 A to T
FTB68007 5164237 C to A
FTB68008 5173177 C to T
FTB68009 5178452 G to C
FTB68010 5202743 G to A
FTB68011 5214035 G to A
FTB68012 5226934 G to A
FTB68013 5231383 T to A
FTB68014 5231456 A to C
FTB68015 5241432 G to C
FTB68016 5244460 G to C
FTB68017 5259379 T to G
FTB68018 5273537 A to T
FTB68019 5279355 G to A
FTB68020 5293073 T to C
FTB68021 5302596 T to C
FTB68022 5312151 A to T
FTB68023 5316238 A to C
FTB68024 5321207 C to T
FTB68025 5332941 A to G
FTB68026 5337659 C to A
FTB68027 5358162 C to A
FTB68028 5361342 C to T
FTB68029 5368163 T to G
FTB68030 5372278 A to T
FTB68031 5372793 C to A
FTB68032 5389381 A to G
FTB68033 5389704 T to A
FTB68034 5400421 T to C
FTB68035 5406114 G to C
FTB68036 5436811 A to G
FTB68037 5445701 T to C
FTB68038 5456610 G to A
FTB68039 5465954 A to G
FTB68040 5471437 C to G
FTB68041 5474478 T to C
FTB68042 5483811 T to G
FTB68043 5493650 G to A
FTB68044 5496121 C to T
FTB68045 5496478 G to A
FTB68046 5508501 T to C
FTB68047 5518044 T to A
FTB68048 5525123 A to G
FTB68049 5533741 T to C
FTB68050 5542571 C to A
FTB68051 5557693 A to C
FTB68052 5572486 G to T
FTB68053 5577415 C to T
FTB68054 5583406 T to C
FTB68055 5584809 A to C
FTB68056 5597820 G to A
FTB68057 5603016 A to G
FTB68058 5613248 T to C
FTB68059 5615640 A to T
FTB68060 5625936 C to T
FTB68061 5630868 A to G
FTB68062 5652002 T to C
FTB68063 5656866 T to C
FTB68064 5664788 G to A
FTB68065 5673961 A to G
FTB68066 5678555 T to C
FTB68067 5722478 T to C
FTB68068 5746365 C to A
FTB68069 5766386 T to G
FTB68070 5777888 A to G
FTB68071 5789415 G to T
FTB68072 5791750 A to T
FTB68073 5795092 T to A
FTB68074 5800648 T to C
FTB68075 5814198 G to A
FTB68076 5826609 C to A
FTB68077 5826743 G to A
FTB68078 5830922 T to C
FTB68079 5839798 G to A
FTB68080 5871990 T to C
FTB68081 5882615 G to A
FTB68082 5886486 A to G
FTB68083 5897732 C to T
FTB68084 5899262 T to C
FTB68085 5911430 A to G
FTB68086 5911712 A to C
FTB68087 5918298 C to A
FTB68088 5931113 A to G
FTB68089 5934174 C to T
FTB68090 5946024 C to T
FTB68091 5948156 C to T
FTB68092 5956311 A to G
FTB68093 5959064 G to T
FTB68094 5962274 G to A
FTB68095 5977972 A to T
FTB68096 5987170 G to A
FTB68097 5987812 G to T
FTB68098 5989109 T to A
FTB68099 6022552 G to A
FTB68100 6027038 A to G
FTB68101 6037933 G to C
FTB68102 6040335 A to G
FTB68103 6057520 C to G
FTB68104 6061780 C to G
FTB68105 6062007 T to C
FTB68106 6083590 T to A
FTB68107 6103758 A to G
FTB68108 6103760 T to A
FTB68109 6103769 T to A
FTB68110 6103784 T to A
FTB68111 6103786 C to T
FTB68112 6119633 G to C
FTB68113 6121316 T to C
FTB68114 6130028 C to T
FTB68115 6151687 A to T
FTB68116 6152839 T to C
FTB68117 6156792 T to C
FTB68118 6161438 T to C
FTB68119 6161746 G to T
FTB68120 6164077 T to C
FTB68121 6164270 G to A
FTB68122 6170201 G to C
FTB68123 6170584 G to T
FTB68124 6185526 G to T
FTB68125 6190130 T to C
FTB68126 6195552 T to A
FTB68127 6206081 A to C
FTB68128 6212368 A to C
FTB68129 6229698 A to T
FTB68130 6233079 A to G
FTB68131 6267533 G to A
FTB68132 6268291 G to T
FTB68133 6271044 G to C
FTB68134 6271092 C to T
FTB68135 6272927 G to T
FTB68136 6287145 C to T
FTB68137 6339745 C to A
FTB68138 6481971 A to C
FTB68139 6502489 C to T
FTB68140 6528811 A to G
FTB68141 6537108 G to C
FTB68142 6545858 A to G
FTB68143 6552325 T to A
FTB68144 6568762 C to A
FTB68145 6595511 C to G
FTB68146 6596850 C to T
FTB68147 6597153 T to G
FTB68148 6597823 A to C
FTB68149 6610239 T to C
FTB68150 6612047 T to C
FTB68151 6625021 T to G
FTB68152 6633888 A to T
FTB68153 6636482 A to G
FTB68154 6638926 A to G
FTB68155 6660895 T to G
FTB68156 6718316 T to C
FTB68157 6742409 G to A
FTB68158 7062651 G to C
FTB68159 9537953 C to T
FTB68160 9541079 C to G
FTB68161 9543056 C to G
FTB68162 9548161 C to T
FTB68163 9548215 A to C
FTB68164 9647554 A to G
FTB68165 9659758 C to T
FTB68166 9660091 G to A
FTB68167 9660747 G to A
FTB68168 9662227 C to A
FTB68169 9664961 A to G
FTB68170 9669647 T to A
FTB68171 9673882 T to A
FTB68172 9674014 G to T
FTB68173 9685157 C to T
FTB68174 9841043 A to T
FTB68175 9890566 G to C
FTB68176 9921023 C to G
FTB68177 9929248 C to G
FTB68178 11687210 G to C
FTB68179 11689762 T to A
FTB68180 11702321 C to T
FTB68181 11703499 T to A
FTB68182 11706333 G to T
FTB68183 11707918 A to G
FTB68184 11711966 T to A
FTB68185 11714266 C to G
FTB68186 11730300 T to G
FTB68187 11735302 C to T
FTB68188 11736618 A to G
FTB68189 11737577 T to C
FTB68190 11745506 C to A
FTB68191 11745578 G to T
FTB68192 13114401 C to T
FTB68193 15883616 A to G
FTB68194 16183452 C to T
FTB68195 16243317 T to A
FTB68196 16379651 G to T
FTB68197 16407015 T to C
FTB68198 19389468 T to C
FTB68199 20351830 C to G
FTB68200 20353135 T to C
FTB68201 21480585 G to A
FTB68202 21481407 A to G
FTB68203 21491124 G to A
FTB68204 21559025 G to A
FTB68205 21573202 T to C
FTB68206 21808894 C to T
FTB68207 21810403 G to C
FTB68208 21850534 C to T
FTB68209 21851081 C to T
FTB68210 22211291 T to C
FTB68211 22336235 C to T
FTB68212 22375690 C to T