Page Actions

FTT SNP index

From ISOGG Wiki

The FTT SNP index lists experimental SNPs discovered by realigning NGS data to the Telomere-to-Telomere (T2T) consortium's complete (but still work-in-progress) assembly of a human Y chromosome from NA24385, an Ashkenazi male belonging to Y-DNA haplogroup J1-M267. Using this assembly allows for discovery of phylogenetically informative SNPs in regions of the Y chromosome where the current official human reference genome (GRCh38) is incomplete or problematic, like parts of the Centromere and DYZ19. These SNPs have been named by Family Tree DNA as they have been considered for experimental inclusion to the Y chromosome haplotree.

Please note that these SNPs may not be mappable to the latest stable version of the human reference genome (GRCh38) due to incompleteness or inaccuracies of that assembly. Positions are therefore provided relative to the CP086569.1 chrY contig and official human reference genome positions will be provided at a future date, when the SNPs can be confidently mapped to an official human reference genome. These SNPs may change or be invalidated by future updates and discoveries.

SNP Position (T2T) Position (hg38) Mutation Haplotree Placement Big Tree Placement
FTT1 CP086569.1:12386062 TBD G to A R-ZZ12_1>FFT1 R-Z46512
FTT2 CP086569.1:11914975 TBD T to G R-ZZ12_1>FTT2
FTT3 CP086569.1:21158054 TBD A to G R-ZZ12_1>FTT2>FFT3 R-ZZ39
FTT4 CP086569.1:21190406 TBD G to T G-Z30728>FTT4>Y30009
FTT5 CP086569.1:11955843 TBD G to T G-Y16788>FTT5
FTT6 CP086569.1:27591916 TBD T to C G-Y16788>FTT5>FTT6
FTT7 CP086569.1:12374983 TBD T to G I-Y4751>FTT7
FTT8 CP086569.1:12239909 TBD A to T R-BY30097>FTT8
FTT9 CP086569.1:12322144 TBD T to C R-DF13>FTT9
FTT10 CP086569.1:12229180 TBD C to T R-U106
FTT11 CP086569.1:12003558 TBD A to C R-BY30097~
FTT12 CP086569.1:11759199 TBD C to T R-L2>FTT12
FTT13 CP086569.1:9045875 TBD C to T I-Z73>FTT13
FTT14 CP086569.1:12151087 TBD A to T I-Z73>FTT14
FTT15 CP086569.1:12115499 TBD G to A I-Z73>FTT14>FTT15
FTT16 CP086569.1:12229180 TBD T to G R-BY64272
FTT17 CP086569.1:12297876 TBD T to A R-L2>FTT17
FTT18 CP086569.1:27463742 TBD G to C R-L2>FTT18
FTT19 CP086569.1:21189033 TBD G to T R-L2>FTT18>FTT19
FTT20 CP086569.1:11917583 TBD G to T R-L2>FTT18>FTT19
FTT21 CP086569.1:12319812 TBD T to G R-L1066>FTT21
FTT22 CP086569.1:11763434 TBD A to G R-L1066>FTT22
FTT23 CP086569.1:27770711 TBD G to T R-L1066>FTT21>FTT23
FTT24 CP086569.1:12143047 TBD G to C R-L1066>FTT21>FTT23
FTT25 CP086569.1:7371862 7720500
ATCAGAAAATGCATTTAATGGCATATGTGCAATTTAGCCCTTACATTATTAAGTGGCTATTCTGAAATAGAAGCCCTGAC
TATAACTCCTAGGCCAGACATTCCTGCAGAATAGTGGTCCAAGGGAGTGGCTATCAGAAACACGTGGTAAGGTTTCATTC
TCCATCTTTTACCAGTCCCATGCTAAAACCTGCAGGTTCCTGGTGAAACACTCCAATATCAGCTTTTTCCCTCATCACCA
CTGGCATTATTGAGCATGATCCAGAACTCTCATTAGTCACCTTCTGTATGCAGGCACTGCAATATTAAGAAACTGCAAAA
AGTAGGACCTGCCTTGGGGGTTCGTTGCAAGTATATCTGTATAAAGTATATTACCCACATATTTAATGTATATATTTTAT
TTAAAATATGTATATGTGTTTTACATATGTATTTTGCAAATATATCATCATAGAGGATATGCTACGTGTCAAAAAAGGTG
GTATAAATACCAAGTGTTACTTGGATTTACATGCCGCTGGGGCATCAGAGAAAGTCTCAAGGAAGGCCTAATCTTTTAAA
ATGGTGGGAGCAGAGAAACATCCGGGTGCAACGTGTCGCCTTTGTGATGCATCATGGAGAACACATTGCTTGGAATGTAT
TCTAGTTGTAATTCTTAATTTATCAAGGTCTTACAACTAACTTCCAGTTTACAGGAAATACAGGCTGGATAAATAAGATC
AATGATGCCATGAGCATTGACCAGATGAAAACATAATATAGGCCATTCTGCAGAATAAGAGGATAGGTTCCTTTTGAGCA
GACAGGTAAAGGGAAAAGGGCTCTTCTAGGCAAAAACAGAAGTGAGGATACAGTCACCACAAACACTGACTGCTGCTGGA
GTGGGTTCTGGTTTGGATGATCAGCTGCAAAGGCCATTTCTGAAACAAAGAGGTGGAGGACTGCTAGGGTAGGAAAGGAC
AAGGACAGGTCAAGGGCATAAGGAGCAAGGAGCAGGGATGGGCAGGGGGGTGGGGCAGGGAAGGCAGGGCAAAGAGAGTA
GTTGGGGATGGGAGACAGGACAGAACAAGAGGAATGCAGGGCGAAGCAGGGAAAGACAGATGGTAGCAGTGGCAGCAGCC
TCAGTGACCAGAGACGGCAGCAGTGATTCTGCAGGCCCAGAGGCCTTGTGAGAAATCAGCCTCCTCGCTGAGCCTTCAGG
GGCAGACAGCCTCAATCTCACCCAAACTCCTGGCTCCCACCCAACTCCTCCTCAACAGCCAGCTCAGCTCAGATTCTCTC
CTCCTGGTCTTTTCCATCCTCTAGAAATAGAGAACCTAGCCTGCATCTCACAGGCTGACATGTTCCTGAGTGCCTGGCTA
CTCTGCTATGCAGTCCCTGGACTCATTCTTGCTTCCCATTGGGTCCTACCACCTCCCTAGAGTGACCCTGGAGTCCTCCT
CTCCCCACCGGGAGAGCTACCAAGGTCCCGCTGGGAGCCACAACTCCTGCCAGCATAGACATGTCTTTTGTCTTCTATCC
CACCCACCTCGTGGGTTCTTTTGGCTACCTACTCCCTTCTTTCTTCCTGCCATCTCCTTGATCTTACTAGCTGGTAACAT
TGACAGTGACTTAATGTCTCTGTGCCTCAGTTTCCACAGCTATAACACAGGCATAACAACAGTACCTACTTCACTGAGGA
ATTATGAGGATGAAGTCAATGCTAAGTTTGAATTCCTGAGACCAGCACCCATACAAACCAACCACTAGGTGTTCATGGTC
AGCAATATGCCCCTCCTCTGTGATCTAAGCTTGCCAAAGCCCATGGGCATTGCTCCCCCATCCCAAGACACCCAGTCATT
CTAAAGTTTAATGAATGACCCAGGGAGAGGAGTCCTAGACACTATGAGCAGGAGCCCAAACTTGAGGACTGTACAAGTGT
TTCTACGTCCTGGGTTGGGAGGCATGGGGAAGGGAGTAATGCCTTGAAAACAGAAGCTCTGGAGTCTGCACTGGGGAATT
CAGGCTGAAACATCACCTTGTTTATGGGACAAAGTTCTCGTGAGTTTTATGACTCTGGAAAAAATTCAGGAGTATAAATT
TATATTTAAGAGTCTTGACTGGTGGCTTTCCAGATGGCAAACAACTTAAAGATATGCTTCTAGCTCTGCCAGATTTATTT
GTAAGGACATTAATTATCTCATTAGAAATAGGTTCCTCTTGGCAATTAGCTTGCTGTTTTTTTTAATTCTGGGTAAAGAA
CATACACATATTTCATCCCTGGCCAATGGACACCTTGGACTTTACAGAGCAGAAATGCCCTAACCCAGTAAGCATTACTC
CCAGTCATACTCTCCCTCCCAACAGACATATAAAGGGTGAAACTGTGTTTAAAATCAGGGTGGTTTTCAATTCATTTTGT
TTTGAGAATGTTGCAGCCCTCCCTGACATGATACGAACAGCTAATGGTGGAGCTCTAAGATATTGGCTGCATATAGGGAG
ATGCCTGGGCTCTGTGGAGGACTTCATCATTGTGCTTGCCAGGGGAAAGCACATGTTCTGTTTTCATGACAGGAAGAATG
AATTTACTGTGGTAAATCCAAAGGAGGCTATGTCAAACACTCAAGTCAAATCTGAAGAAAAAGCTGTCTAAGTTGTCTAC
ATTTGTGGACTCCAGGTTGAAGAGTGGGGTGACAGGGAGAAGAGGAGTCTAACTCAGCCTTGATTACCAAATCATAATGG
TAGAGGACCAGTAAATGGTTTTGTGAATGTTCCAGGTGTACTTTCTAGGGGGTCTTAGGGTCCCTGATGTGCTCAGGCAG
TGGGGAAAAAGAGAAAACCTTCCTTTTGATTCCATAATTTATCTAATAGCGGAAGAAATTCCAAGTGGCCACCTCTGTAC
CCACTATCTCCAGCACCTCCCTACACACTTTCAACAATTAATCATCAGTTTCCTGGGGAGGAATGTAAAACTATGTGTGG
CCACAGAGAGCATCTATGGGCACTGAGAGGGGATGAAAAGAGTCACTGTTGCTGCAACCCAAGATGAGCAATGGGGTGTC
CCCACAGGAAAAAAGGAGCCAAAGCATTCCTTCCTGGTCTCTGCTGACACTGATAAGTCAGGCTGTAGACATCTGTCCCA
AGTTGTCCCCATGCATGTACCACCACTGGTGTTTTATGATGCATCTCAAACCAGACCATGAAAACCCCTGACTTTGAGGA
ACTTTGCAGGTACCCATGGAGGGCTTCCTTGTATAGAGGGAGGTTGCCCTCCTTGCCACTAGGGCACAGAAGTGACCCTA
CATTAGTTTTACTAAAGATATGTGTATTATAGAACTGCACTGACCAAG to C
R-M269
FTT26 CP086569.1:7374784 N/A G to A BT
FTT27 CP086569.1:7374062 N/A A to GG P~
FTT28 CP086569.1:12248551 TBD G to T J-FGC2>FTT28
FTT29 CP086569.1:7373637 N/A C to G M-M5
FTT30 CP086569.1:7372133 N/A A to T S-Z41932~
FTT31 CP086569.1:7373954 N/A T to A D~
FTT32 CP086569.1:27805566 TBD T to A R-FGC11674>FTT32
FTT33 CP086569.1:12231085 TBD C to A R-FGC11674>FTT32>FTT33
FTT34 CP086569.1:11754261 TBD G to A R-FT462819
FTT35 CP086569.1:11929119 TBD G to T R-FGC19845>FTT35

Big Tree T2T SNPs

SNP Position (T2T) Position (hg38) Mutation Haplotree Placement Big Tree Placement
Z46516 CP086569.1:12393262 TBD G to T R-P312>Z46516 R-Z40481
Z46517 CP086569.1:11964529 TBD T to C R-DF13 R-DF13
Z46518 CP086569.1:11972404 TBD A to T R-L21 R-L21
Z46519 CP086569.1:12243351 TBD G to A R-L21 R-L21
ZZ96_1 CP086569.1:12197809 TBD T to A R-FGC84729

See also