Page Actions

FTT SNP index

From ISOGG Wiki

The FTT SNP index lists experimental SNPs discovered by realigning NGS data to the Telomere-to-Telomere (T2T) consortium's complete (but still work-in-progress) assembly of a human Y chromosome from NA24385, an Ashkenazi male belonging to Y-DNA haplogroup J1-M267. Using this assembly allows for discovery of phylogenetically informative SNPs in regions of the Y chromosome where the current official human reference genome (GRCh38) is incomplete or problematic, like parts of the Centromere and DYZ19. These SNPs have been named by Family Tree DNA as they have been considered for experimental inclusion to the Y chromosome haplotree.

Please note that these SNPs may not be mappable to the latest stable version of the human reference genome (GRCh38) due to incompleteness or inaccuracies of that assembly. Positions are therefore provided relative to the CP086569.2 chrY contig and official human reference genome positions will be provided at a future date, when the SNPs can be confidently mapped to an official human reference genome. These SNPs may change or be invalidated by future updates and discoveries.

SNP Position (HG002v2) Position (HG002v2.7) Position (hg38) Mutation Haplotree Placement Big Tree Placement
FTT1 CP086569.1:12386062 CP086569.2:12387377 TBD G to A R-ZZ12_1>FFT1 R-Z46512
FTT2 CP086569.1:11914975 CP086569.2:11916290 TBD T to G R-ZZ12_1>FTT2
FTT3 CP086569.1:21158054 CP086569.2:21159359 TBD A to G R-ZZ12_1>FTT2>FFT3 R-ZZ39
FTT4 CP086569.1:21190406 CP086569.2:21191711 TBD G to T G-Z30728>FTT4>Y30009
FTT5 CP086569.1:11955843 CP086569.2:11957158 TBD G to T G-Y16788>FTT5
FTT6 CP086569.1:27591916 CP086569.2:27593216 TBD T to C G-Y16788>FTT5>FTT6
FTT7 CP086569.1:12374983 CP086569.2:12376298 TBD T to G I-Y4751>FTT7
FTT8 CP086569.1:12239909 CP086569.2:12241224 TBD A to T R-BY30097>FTT8
FTT9 CP086569.1:12322144 CP086569.2:12323459 TBD T to C R-DF13>FTT9
FTT10 CP086569.1:12229180 CP086569.2:12230495 TBD C to T R-U106
FTT11 CP086569.1:12003558 CP086569.2:12004873 TBD A to C R-BY30097~
FTT12 CP086569.1:11759199 CP086569.2:11760514 TBD C to T R-L2>FTT12
FTT13 CP086569.1:9045875 CP086569.2:9047188 TBD C to T I-Z73>FTT13
FTT14 CP086569.1:12151087 CP086569.2:12152402 TBD A to T I-Z73>FTT14
FTT15 CP086569.1:12115499 CP086569.2:12116814 TBD G to A I-Z73>FTT14>FTT15
FTT16 CP086569.1:12229180 CP086569.2:12230495 TBD T to G R-BY64272
FTT17 CP086569.1:12297876 CP086569.2:12299191 TBD T to A R-L2>FTT17
FTT18 CP086569.1:27463742 CP086569.2:27465042 TBD G to C R-L2>FTT18
FTT19 CP086569.1:21189033 CP086569.2:21190338 TBD G to T R-L2>FTT18>FTT19
FTT20 CP086569.1:11917583 CP086569.2:11918898 TBD G to T R-L2>FTT18>FTT19
FTT21 CP086569.1:12319812 CP086569.2:12321127 TBD T to G R-L1066>FTT21
FTT22 CP086569.1:11763434 CP086569.2:11764749 TBD A to G R-L1066>FTT22
FTT23 CP086569.1:27770711 CP086569.2:27772011 TBD G to T R-L1066>FTT21>FTT23
FTT24 CP086569.1:12143047 CP086569.2:12144362 TBD G to C R-L1066>FTT21>FTT23
FTT25 CP086569.1:7371862 CP086569.2:7373171 7720500
ATCAGAAAATGCATTTAATGGCATATGTGCAATTTAGCCCTTACATTATTAAGTGGCTATTCTGAAATAGAAGCCCTGAC
TATAACTCCTAGGCCAGACATTCCTGCAGAATAGTGGTCCAAGGGAGTGGCTATCAGAAACACGTGGTAAGGTTTCATTC
TCCATCTTTTACCAGTCCCATGCTAAAACCTGCAGGTTCCTGGTGAAACACTCCAATATCAGCTTTTTCCCTCATCACCA
CTGGCATTATTGAGCATGATCCAGAACTCTCATTAGTCACCTTCTGTATGCAGGCACTGCAATATTAAGAAACTGCAAAA
AGTAGGACCTGCCTTGGGGGTTCGTTGCAAGTATATCTGTATAAAGTATATTACCCACATATTTAATGTATATATTTTAT
TTAAAATATGTATATGTGTTTTACATATGTATTTTGCAAATATATCATCATAGAGGATATGCTACGTGTCAAAAAAGGTG
GTATAAATACCAAGTGTTACTTGGATTTACATGCCGCTGGGGCATCAGAGAAAGTCTCAAGGAAGGCCTAATCTTTTAAA
ATGGTGGGAGCAGAGAAACATCCGGGTGCAACGTGTCGCCTTTGTGATGCATCATGGAGAACACATTGCTTGGAATGTAT
TCTAGTTGTAATTCTTAATTTATCAAGGTCTTACAACTAACTTCCAGTTTACAGGAAATACAGGCTGGATAAATAAGATC
AATGATGCCATGAGCATTGACCAGATGAAAACATAATATAGGCCATTCTGCAGAATAAGAGGATAGGTTCCTTTTGAGCA
GACAGGTAAAGGGAAAAGGGCTCTTCTAGGCAAAAACAGAAGTGAGGATACAGTCACCACAAACACTGACTGCTGCTGGA
GTGGGTTCTGGTTTGGATGATCAGCTGCAAAGGCCATTTCTGAAACAAAGAGGTGGAGGACTGCTAGGGTAGGAAAGGAC
AAGGACAGGTCAAGGGCATAAGGAGCAAGGAGCAGGGATGGGCAGGGGGGTGGGGCAGGGAAGGCAGGGCAAAGAGAGTA
GTTGGGGATGGGAGACAGGACAGAACAAGAGGAATGCAGGGCGAAGCAGGGAAAGACAGATGGTAGCAGTGGCAGCAGCC
TCAGTGACCAGAGACGGCAGCAGTGATTCTGCAGGCCCAGAGGCCTTGTGAGAAATCAGCCTCCTCGCTGAGCCTTCAGG
GGCAGACAGCCTCAATCTCACCCAAACTCCTGGCTCCCACCCAACTCCTCCTCAACAGCCAGCTCAGCTCAGATTCTCTC
CTCCTGGTCTTTTCCATCCTCTAGAAATAGAGAACCTAGCCTGCATCTCACAGGCTGACATGTTCCTGAGTGCCTGGCTA
CTCTGCTATGCAGTCCCTGGACTCATTCTTGCTTCCCATTGGGTCCTACCACCTCCCTAGAGTGACCCTGGAGTCCTCCT
CTCCCCACCGGGAGAGCTACCAAGGTCCCGCTGGGAGCCACAACTCCTGCCAGCATAGACATGTCTTTTGTCTTCTATCC
CACCCACCTCGTGGGTTCTTTTGGCTACCTACTCCCTTCTTTCTTCCTGCCATCTCCTTGATCTTACTAGCTGGTAACAT
TGACAGTGACTTAATGTCTCTGTGCCTCAGTTTCCACAGCTATAACACAGGCATAACAACAGTACCTACTTCACTGAGGA
ATTATGAGGATGAAGTCAATGCTAAGTTTGAATTCCTGAGACCAGCACCCATACAAACCAACCACTAGGTGTTCATGGTC
AGCAATATGCCCCTCCTCTGTGATCTAAGCTTGCCAAAGCCCATGGGCATTGCTCCCCCATCCCAAGACACCCAGTCATT
CTAAAGTTTAATGAATGACCCAGGGAGAGGAGTCCTAGACACTATGAGCAGGAGCCCAAACTTGAGGACTGTACAAGTGT
TTCTACGTCCTGGGTTGGGAGGCATGGGGAAGGGAGTAATGCCTTGAAAACAGAAGCTCTGGAGTCTGCACTGGGGAATT
CAGGCTGAAACATCACCTTGTTTATGGGACAAAGTTCTCGTGAGTTTTATGACTCTGGAAAAAATTCAGGAGTATAAATT
TATATTTAAGAGTCTTGACTGGTGGCTTTCCAGATGGCAAACAACTTAAAGATATGCTTCTAGCTCTGCCAGATTTATTT
GTAAGGACATTAATTATCTCATTAGAAATAGGTTCCTCTTGGCAATTAGCTTGCTGTTTTTTTTAATTCTGGGTAAAGAA
CATACACATATTTCATCCCTGGCCAATGGACACCTTGGACTTTACAGAGCAGAAATGCCCTAACCCAGTAAGCATTACTC
CCAGTCATACTCTCCCTCCCAACAGACATATAAAGGGTGAAACTGTGTTTAAAATCAGGGTGGTTTTCAATTCATTTTGT
TTTGAGAATGTTGCAGCCCTCCCTGACATGATACGAACAGCTAATGGTGGAGCTCTAAGATATTGGCTGCATATAGGGAG
ATGCCTGGGCTCTGTGGAGGACTTCATCATTGTGCTTGCCAGGGGAAAGCACATGTTCTGTTTTCATGACAGGAAGAATG
AATTTACTGTGGTAAATCCAAAGGAGGCTATGTCAAACACTCAAGTCAAATCTGAAGAAAAAGCTGTCTAAGTTGTCTAC
ATTTGTGGACTCCAGGTTGAAGAGTGGGGTGACAGGGAGAAGAGGAGTCTAACTCAGCCTTGATTACCAAATCATAATGG
TAGAGGACCAGTAAATGGTTTTGTGAATGTTCCAGGTGTACTTTCTAGGGGGTCTTAGGGTCCCTGATGTGCTCAGGCAG
TGGGGAAAAAGAGAAAACCTTCCTTTTGATTCCATAATTTATCTAATAGCGGAAGAAATTCCAAGTGGCCACCTCTGTAC
CCACTATCTCCAGCACCTCCCTACACACTTTCAACAATTAATCATCAGTTTCCTGGGGAGGAATGTAAAACTATGTGTGG
CCACAGAGAGCATCTATGGGCACTGAGAGGGGATGAAAAGAGTCACTGTTGCTGCAACCCAAGATGAGCAATGGGGTGTC
CCCACAGGAAAAAAGGAGCCAAAGCATTCCTTCCTGGTCTCTGCTGACACTGATAAGTCAGGCTGTAGACATCTGTCCCA
AGTTGTCCCCATGCATGTACCACCACTGGTGTTTTATGATGCATCTCAAACCAGACCATGAAAACCCCTGACTTTGAGGA
ACTTTGCAGGTACCCATGGAGGGCTTCCTTGTATAGAGGGAGGTTGCCCTCCTTGCCACTAGGGCACAGAAGTGACCCTA
CATTAGTTTTACTAAAGATATGTGTATTATAGAACTGCACTGACCAAG to C
R-M269
FTT26 CP086569.1:7374784 CP086569.2:7376093 TBD G to A BT
FTT27 CP086569.1:7374062 CP086569.2:7375371 TBD A to GG P~
FTT28 CP086569.1:12248551 CP086569.2:12249866 TBD G to T J-FGC2>FTT28
FTT29 CP086569.1:7373637 CP086569.2:7374946 TBD C to G M-M5
FTT30 CP086569.1:7372133 CP086569.2:7373442 TBD A to T S-Z41932~
FTT31 CP086569.1:7373954 CP086569.2:7375263 TBD T to A D~
FTT32 CP086569.1:27805566 CP086569.2:27806866 TBD T to A R-FGC11674>FTT32
FTT33 CP086569.1:12231085 CP086569.2:12232400 TBD C to A R-FGC11674>FTT32>FTT33
FTT34 CP086569.1:11754261 CP086569.2:11755576 TBD G to A R-FT462819
FTT35 CP086569.1:11929119 CP086569.2:11930434 TBD G to T R-FGC19845>FTT35
FTT36 CP086569.1:21015837 CP086569.2:21017142 TBD A to T I-Y19707>FTT36
FTT37 CP086569.1:11958413 CP086569.2:11959728 TBD T to G G-BY21824>FTT37
FTT38 CP086569.1:12474706 CP086569.2:12476021 TBD G to T G-Z41276>FTT38
FTT39 CP086569.1:12160958 CP086569.2:12162273 TBD A to T G-Z31206>FTT39
FTT40 CP086569.1:11989647 CP086569.2:11990962 TBD A to G J-ZS1707>FTT40
FTT41 CP086569.1:12172559 CP086569.2:12173874 TBD T to C R-S781>FTT41
FTT42 CP086569.1:12094153 CP086569.2:12095468 TBD G to T R-S781>FTT41>FTT42
FTT43 CP086569.1:11246084 CP086569.2:11247398 TBD T to C R-S781>FGC70765>FTT43
FTT44 CP086569.1:11556656 CP086569.2:11557971 11336621 T to A R-ZZ52_1>FTT44
FTT45 CP086569.1:11638201 CP086569.2:11639516 11418169 G to T R-ZZ52_1>FTT44
FTT46 CP086569.1:21150825 CP086569.2:21152130 TBD C to A R-Z38845>FTT46
FTT47 CP086569.1:21150487 CP086569.2:21151792 TBD G to A R-Z38845
FTT48 CP086569.1:21178994 CP086569.2:21180299 TBD C to T R-S781>FTT48
FTT49 CP086569.1:12250653 CP086569.2:12251968 TBD G to C E-BY3880>FTT49
FTT50 CP086569.1:20980988 CP086569.2:20982293 TBD T to C E-S19928>FTT50
FTT51 CP086569.1:21152688 CP086569.2:21153993 TBD G to A E-S19928>FTT50
FTT52 CP086569.1:12067215 CP086569.2:12068530 TBD T to A E-CTS6377>FTT52
FTT53 CP086569.1:12501035 CP086569.2:12502350 TBD G to T E-FT4748>FTT53
FTT54 CP086569.1:11768042 CP086569.2:11769357 TBD G to T E-FT4748>FTT53
FTT55 CP086569.1:21024769 CP086569.2:21026074 TBD G to T E-FTT53>FTT55
FTT56 CP086569.1:11914608 CP086569.2:11915923 TBD A to T R-BY27673>FTT56
FTT57 CP086569.1:21000874 CP086569.2:21002179 TBD A to G R-BY27673>FTT57
FTT58 CP086569.1:3120042 CP086569.2:3121355 TBD C to T R-BY27673>FTT57
FTT59 CP086569.1:12043286 CP086569.2:12044601 TBD G to A I-A815
FTT60 CP086569.1:12103825 CP086569.2:12105140 TBD G to A I-FGC92673>FTT60
FTT61 CP086569.1:11534837 CP086569.2:11536152 TBD C to A I-PH908
FTT62 CP086569.1:12099703 CP086569.2:12101018 TBD G to T I-PH908>FTT62
FTT63 CP086569.1:21144062 CP086569.2:21145367 TBD C to G I-PH908>FTT63
FTT64 CP086569.1:11838477 CP086569.2:11839792 TBD A to T I-FT277965
FTT65 CP086569.1:11911990 CP086569.2:11913305 TBD G to A I-PH908>FTT63>FTT65
FTT66 CP086569.1:21119762 CP086569.2:21121067 TBD C to A I-FGC9506>FTT66
FTT67 CP086569.1:27792303 CP086569.2:27793603 TBD G to A E-FTC5921
FTT68 CP086569.1:27820957 CP086569.2:27822257 TBD T to C R-FGC48870>FTT68
FTT69 CP086569.1:21161634 CP086569.2:21162939 TBD C to G R-FTT68>FTT69
FTT70 CP086569.1:21145724 CP086569.2:21147029 TBD C to A R-FGC48870>FTT70
FTT71 CP086569.1:12070631 CP086569.2:12071946 TBD T to C R-FTA58795
FTT72 CP086569.1:11528329 CP086569.2:11529644 TBD C to T R-FGC34569>FTT72
FTT73 CP086569.1:22638811 CP086569.2:22640113 TBD G to T R-FGC11986>FTT73
FTT74 CP086569.1:11994000 CP086569.2:11995315 TBD T to C R-FGC3222>FTT74
FTT75 CP086569.1:27591914 CP086569.2:27593214 TBD A to T R-FGC3222>FTT74>FTT75
FTT76 CP086569.1:12350269 CP086569.2:12351584 TBD G to T R-CTS4299>FTT76
FTT77 CP086569.1:21221651 CP086569.2:21222956 TBD C to T R-FTC6662>FTT77
FTT78 CP086569.1:21223886 CP086569.2:21225191 TBD G to A R-BY32648>FTT78
FTT79 CP086569.1:12155753 CP086569.2:12157068 TBD G to A R-FTT78
FTT80 CP086569.1:12182332 CP086569.2:12183647 TBD T to A R-A9872>FTT80
FTT81 CP086569.1:27556530 CP086569.2:27557830 TBD T to G R-A9872>FTT81
FTT82 CP086569.1:12189437 CP086569.2:12190752 TBD A to G R-FT74650>FTT82
FTT83 CP086569.1:20968939 CP086569.2:20970244 TBD C to T R-Z16339>FTT83
FTT84 CP086569.1:21206333 CP086569.2:21207638 TBD T to G R-YP268>FTT84
FTT85 CP086569.1:11996492 CP086569.2:11997807 TBD A to T R-M756>FTT85
FTT86 CP086569.1:12375159 CP086569.2:12376474 TBD G to C R-FTT85>FTT86
FTT87 CP086569.1:27565128 CP086569.2:27566428 TBD G to T R-FTT86>FTT87
FTT88 CP086569.1:27694756 CP086569.2:27696056 TBD A to G R-FTB92093>FTT88
FTT89 CP086569.1:12298488 CP086569.2:12299803 TBD G to C R-FTT88>FTT89
FTT90 CP086569.1:21157530 CP086569.2:21158835 TBD A to T R-FT194987>FTT90
FTT91 CP086569.1:11997725 CP086569.2:11999040 TBD A to G R-Y2915>FTT91
FTT92 CP086569.1:12288779 CP086569.2:12290094 TBD A to G R-YP362>FTT92
FTT93 CP086569.1:11956684 CP086569.2:11957999 TBD T to G R-YP358>FTT93
FTT94 CP086569.1:12241731 CP086569.2:12243046 TBD C to A R-BY29802>FTT94
FTT95 CP086569.1:12257149 CP086569.2:12258464 TBD A to G R-Z31644>FTT95
FTT96 CP086569.1:27712058 CP086569.2:27713358 TBD T to A R-Z31644>FTT96
FTT97 CP086569.1:12294825 CP086569.2:12296140 TBD C to G R-FTT96>FTT97
FTT98 CP086569.1:12469864 CP086569.2:12471179 TBD A to G R-FTT96>FTT98
FTT99 CP086569.1:27666644 CP086569.2:27667944 TBD T to G R-Y32298
FTT100 CP086569.1:12131792 CP086569.2:12133107 TBD A to C R-BY171013>FTT100
FTT101 CP086569.1:11991683 CP086569.2:11992998 TBD C to G R-FTT100>FTT101
FTT102 CP086569.1:27500510 CP086569.2:27501810 TBD G to T N-Y4374>FTT102
FTT103 CP086569.1:11838938 CP086569.2:11840253 TBD G to A N-FTT102>FTT103
FTT104 CP086569.1:11754514 CP086569.2:11755829 TBD G to C N-FTT103>FTT104
FTT105 CP086569.1:12182311 CP086569.2:12183626 TBD T to C E-Z5009>FTT105
FTT106 CP086569.1:27736137 CP086569.2:27737437 TBD G to C E-Z5009>FTT106

Big Tree T2T SNPs

SNP Position (HG002v2) Position (HG002v2.7) Position (hg38) Mutation Haplotree Placement Big Tree Placement
Z46516 CP086569.1:12393262 CP086569.2:12394577 TBD C to T R-P312>Z46516 R-Z40481
Z46517 CP086569.1:11964529 CP086569.2:11965844 TBD G to C R-DF13 R-DF13
Z46518 CP086569.1:11972404 CP086569.2:11973719 TBD A to T R-L21 R-L21
Z46519 CP086569.1:12243351 CP086569.2:12244666 TBD G to A R-L21 R-L21
ZZ96_1 CP086569.1:12197809 CP086569.2:12199124 TBD T to A R-FGC84729

See also